Incidental Mutation 'R5876:Mrps9'
ID 455511
Institutional Source Beutler Lab
Gene Symbol Mrps9
Ensembl Gene ENSMUSG00000060679
Gene Name mitochondrial ribosomal protein S9
Synonyms
Accession Numbers
Essential gene? Probably essential (E-score: 0.901) question?
Stock # R5876 (G1)
Quality Score 212
Status Not validated
Chromosome 1
Chromosomal Location 42851233-42905683 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 42895378 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 173 (E173G)
Ref Sequence ENSEMBL: ENSMUSP00000056855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057208]
AlphaFold Q9D7N3
Predicted Effect probably damaging
Transcript: ENSMUST00000057208
AA Change: E173G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000056855
Gene: ENSMUSG00000060679
AA Change: E173G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 194 207 N/A INTRINSIC
Pfam:Ribosomal_S9 268 390 7.3e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187414
Predicted Effect unknown
Transcript: ENSMUST00000201108
AA Change: E26G
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,663,582 D64G possibly damaging Het
Ano2 T A 6: 126,039,279 M925K possibly damaging Het
Arnt2 T C 7: 84,347,512 T69A probably damaging Het
Asap2 T A 12: 21,212,809 N229K possibly damaging Het
Atp13a3 T A 16: 30,362,734 N23Y probably benign Het
Cbr4 G A 8: 61,490,593 G91R possibly damaging Het
Cdc27 A T 11: 104,515,418 C624S probably benign Het
Cdc42bpg T A 19: 6,310,815 I201N probably damaging Het
Cdh5 A G 8: 104,142,577 Y645C probably damaging Het
Celsr2 C T 3: 108,413,943 V518I probably damaging Het
Clca4b T C 3: 144,912,060 T761A possibly damaging Het
Cpne4 C A 9: 104,925,770 S204R probably damaging Het
Dcaf1 T C 9: 106,863,650 W1279R probably damaging Het
Dennd4a C T 9: 64,911,755 P1731S probably damaging Het
Dmxl1 T A 18: 49,870,984 V892D possibly damaging Het
Fam131b A G 6: 42,321,248 probably null Het
Fam83b T A 9: 76,491,850 D657V possibly damaging Het
Fam83e T A 7: 45,722,363 probably null Het
Fbxo4 A T 15: 3,977,819 I121N probably damaging Het
Gabrg2 A G 11: 41,968,820 S202P probably damaging Het
Gm10471 T C 5: 26,084,718 E237G probably damaging Het
Grid2 T A 6: 64,663,162 I788N probably damaging Het
Grik4 T A 9: 42,688,023 N53Y probably damaging Het
Hipk2 A C 6: 38,730,867 probably null Het
Hps5 T C 7: 46,789,196 T38A probably damaging Het
Hs1bp3 A G 12: 8,341,843 D315G possibly damaging Het
Kdm4a C T 4: 118,138,876 M985I probably damaging Het
Kdm5d A G Y: 900,525 Y190C probably damaging Het
Krt86 T C 15: 101,476,610 S295P probably damaging Het
Matr3 T A 18: 35,587,738 D413E probably benign Het
Mbd5 T A 2: 49,274,645 F319L probably damaging Het
Mcoln1 T A 8: 3,510,910 Y411N probably damaging Het
Mpdz C A 4: 81,285,474 E1863* probably null Het
Olfr8 A T 10: 78,955,357 I51F probably benign Het
Osmr T C 15: 6,821,047 T692A probably benign Het
Pkhd1l1 A T 15: 44,578,588 H3641L possibly damaging Het
Pml T C 9: 58,233,182 T421A possibly damaging Het
Podxl A G 6: 31,528,456 probably null Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prkag3 A G 1: 74,748,816 probably benign Het
Proz A G 8: 13,073,448 R240G probably benign Het
Ptpn13 C A 5: 103,476,960 D43E probably damaging Het
Rbm5 T G 9: 107,760,326 K135N probably damaging Het
Ska1 G A 18: 74,197,528 T201M probably damaging Het
Slc35f5 A C 1: 125,587,363 probably null Het
Slc9a3 T C 13: 74,161,723 L510P probably damaging Het
Svil A G 18: 5,082,828 K1231E probably damaging Het
Tanc2 T C 11: 105,922,613 S1628P possibly damaging Het
Tm9sf3 T A 19: 41,240,584 D260V probably damaging Het
Ttc9 G T 12: 81,631,622 R73L probably damaging Het
Vps13b A G 15: 35,917,061 I3684V probably damaging Het
Vps8 T C 16: 21,461,439 probably null Het
Vwa3b T A 1: 37,076,439 I328N probably damaging Het
Wdr1 C T 5: 38,530,023 V222M probably benign Het
Xpnpep1 T A 19: 52,997,008 T530S probably damaging Het
Zc3h6 C T 2: 128,993,277 S111F probably benign Het
Zfp768 G A 7: 127,344,546 P137S probably benign Het
Other mutations in Mrps9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Mrps9 APN 1 42905459 missense probably damaging 1.00
IGL01134:Mrps9 APN 1 42903397 missense probably damaging 0.97
IGL01557:Mrps9 APN 1 42851350 missense probably benign
IGL02541:Mrps9 APN 1 42862654 splice site probably null
PIT4402001:Mrps9 UTSW 1 42896098 missense probably benign 0.10
R0598:Mrps9 UTSW 1 42905417 missense probably damaging 1.00
R1718:Mrps9 UTSW 1 42903399 missense probably damaging 1.00
R4195:Mrps9 UTSW 1 42901094 intron probably benign
R4196:Mrps9 UTSW 1 42901094 intron probably benign
R4695:Mrps9 UTSW 1 42862515 missense possibly damaging 0.59
R4840:Mrps9 UTSW 1 42898415 intron probably benign
R5033:Mrps9 UTSW 1 42895331 splice site probably null
R5489:Mrps9 UTSW 1 42898433 splice site probably benign
R6891:Mrps9 UTSW 1 42905413 missense probably damaging 1.00
R7015:Mrps9 UTSW 1 42898546 missense probably benign 0.04
R7940:Mrps9 UTSW 1 42862648 missense probably damaging 0.98
R8679:Mrps9 UTSW 1 42879755 missense probably damaging 0.99
R9117:Mrps9 UTSW 1 42903377 missense probably benign 0.22
Z1177:Mrps9 UTSW 1 42899458 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CCTTGGCTCAGATGAGAACTC -3'
(R):5'- GGTCATGGAGCTGACTGATCAC -3'

Sequencing Primer
(F):5'- CTTTACTCTGAAGCTGACTGAGAAGG -3'
(R):5'- TGGAGCTGACTGATCACCTATACAG -3'
Posted On 2017-02-10