Mutagenetix > Incidental Mutation

Incidental Mutation 'R5876:Mpdz'

455518

Institutional Source

Beutler Lab

Gene Symbol

Mpdz

Ensembl Gene

ENSMUSG00000028402

Gene Name

multiple PDZ domain protein

Synonyms

B930003D11Rik, MUPP1

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5876 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

81278500-81442815 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 81285474 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 1863 (E1863*)

Ref Sequence

ENSEMBL: ENSMUSP00000152533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102830] [ENSMUST00000107258] [ENSMUST00000107262] [ENSMUST00000131547] [ENSMUST00000134726] [ENSMUST00000220807]

AlphaFold

Q8VBX6

Predicted Effect

probably null
Transcript: ENSMUST00000102830
AA Change: E1849*

SMART Domains

Protein: ENSMUSP00000099894
Gene: ENSMUSG00000028402
AA Change: E1849*

Domain	Start	End	E-Value	Type
L27	6	66	9.04e-3	SMART
PDZ	147	225	3.03e-23	SMART
PDZ	266	338	8.92e-21	SMART
low complexity region	345	360	N/A	INTRINSIC
PDZ	386	464	6.07e-23	SMART
PDZ	556	627	7.31e-17	SMART
PDZ	701	780	9.94e-19	SMART
PDZ	1004	1080	3.44e-13	SMART
low complexity region	1111	1126	N/A	INTRINSIC
PDZ	1148	1231	2.43e-22	SMART
low complexity region	1233	1251	N/A	INTRINSIC
PDZ	1346	1421	3.41e-17	SMART
low complexity region	1434	1445	N/A	INTRINSIC
low complexity region	1454	1468	N/A	INTRINSIC
PDZ	1479	1552	2.69e-15	SMART
PDZ	1622	1697	3.2e-22	SMART
PDZ	1719	1792	3.62e-21	SMART
low complexity region	1798	1815	N/A	INTRINSIC
PDZ	1856	1933	9.79e-18	SMART
PDZ	1980	2055	2.39e-21	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000107258
AA Change: E1816*

SMART Domains

Protein: ENSMUSP00000102879
Gene: ENSMUSG00000028402
AA Change: E1816*

Domain	Start	End	E-Value	Type
PDZ	1	73	3.42e-8	SMART
low complexity region	104	119	N/A	INTRINSIC
PDZ	141	224	2.43e-22	SMART
PDZ	306	381	3.41e-17	SMART
low complexity region	394	405	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
PDZ	439	512	2.69e-15	SMART
PDZ	582	657	3.2e-22	SMART
PDZ	679	752	3.62e-21	SMART
low complexity region	758	775	N/A	INTRINSIC
PDZ	816	893	9.79e-18	SMART
PDZ	940	1015	2.39e-21	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000107262
AA Change: E1850*

SMART Domains

Protein: ENSMUSP00000102883
Gene: ENSMUSG00000028402
AA Change: E1850*

Domain	Start	End	E-Value	Type
L27	6	66	9.04e-3	SMART
PDZ	147	225	3.03e-23	SMART
PDZ	266	338	8.92e-21	SMART
low complexity region	345	360	N/A	INTRINSIC
PDZ	386	464	6.07e-23	SMART
PDZ	556	627	7.31e-17	SMART
PDZ	701	780	9.94e-19	SMART
PDZ	1004	1080	3.44e-13	SMART
low complexity region	1112	1127	N/A	INTRINSIC
PDZ	1149	1232	2.43e-22	SMART
low complexity region	1234	1252	N/A	INTRINSIC
PDZ	1347	1422	3.41e-17	SMART
low complexity region	1435	1446	N/A	INTRINSIC
low complexity region	1455	1469	N/A	INTRINSIC
PDZ	1480	1553	2.69e-15	SMART
PDZ	1623	1698	3.2e-22	SMART
PDZ	1720	1793	3.62e-21	SMART
low complexity region	1799	1816	N/A	INTRINSIC
PDZ	1857	1934	9.79e-18	SMART
PDZ	1981	2056	2.39e-21	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124805

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129732

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131418

Predicted Effect

probably null
Transcript: ENSMUST00000131547
AA Change: E185*

SMART Domains

Protein: ENSMUSP00000116767
Gene: ENSMUSG00000028402
AA Change: E185*

Domain	Start	End	E-Value	Type
Blast:PDZ	1	33	8e-15	BLAST
PDB:2OPG\|B	1	37	1e-19	PDB
PDZ	55	128	3.62e-21	SMART
low complexity region	134	151	N/A	INTRINSIC
Blast:PDZ	167	209	1e-11	BLAST
PDB:2IWP\|B	173	209	3e-6	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000134726
AA Change: E289*

SMART Domains

Protein: ENSMUSP00000116830
Gene: ENSMUSG00000028402
AA Change: E289*

Domain	Start	End	E-Value	Type
PDZ	90	137	7.6e0	SMART
PDZ	159	232	3.62e-21	SMART
low complexity region	238	255	N/A	INTRINSIC
PDZ	296	373	9.79e-18	SMART
PDZ	420	495	2.39e-21	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156441

Predicted Effect

probably null
Transcript: ENSMUST00000220807
AA Change: E1863*

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has multiple PDZ domains, which are hallmarks of protein-protein interactions. The encoded protein is known to interact with the HTR2C receptor and may cause it to clump at the cell surface. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mutant heterozygous mice are more sensitive to ethanol withdrawal effects and consume less alcohol than controls. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034E13Rik	A	G	18: 52,663,582	D64G	possibly damaging	Het
Ano2	T	A	6: 126,039,279	M925K	possibly damaging	Het
Arnt2	T	C	7: 84,347,512	T69A	probably damaging	Het
Asap2	T	A	12: 21,212,809	N229K	possibly damaging	Het
Atp13a3	T	A	16: 30,362,734	N23Y	probably benign	Het
Cbr4	G	A	8: 61,490,593	G91R	possibly damaging	Het
Cdc27	A	T	11: 104,515,418	C624S	probably benign	Het
Cdc42bpg	T	A	19: 6,310,815	I201N	probably damaging	Het
Cdh5	A	G	8: 104,142,577	Y645C	probably damaging	Het
Celsr2	C	T	3: 108,413,943	V518I	probably damaging	Het
Clca4b	T	C	3: 144,912,060	T761A	possibly damaging	Het
Cpne4	C	A	9: 104,925,770	S204R	probably damaging	Het
Dcaf1	T	C	9: 106,863,650	W1279R	probably damaging	Het
Dennd4a	C	T	9: 64,911,755	P1731S	probably damaging	Het
Dmxl1	T	A	18: 49,870,984	V892D	possibly damaging	Het
Fam131b	A	G	6: 42,321,248		probably null	Het
Fam83b	T	A	9: 76,491,850	D657V	possibly damaging	Het
Fam83e	T	A	7: 45,722,363		probably null	Het
Fbxo4	A	T	15: 3,977,819	I121N	probably damaging	Het
Gabrg2	A	G	11: 41,968,820	S202P	probably damaging	Het
Gm10471	T	C	5: 26,084,718	E237G	probably damaging	Het
Grid2	T	A	6: 64,663,162	I788N	probably damaging	Het
Grik4	T	A	9: 42,688,023	N53Y	probably damaging	Het
Hipk2	A	C	6: 38,730,867		probably null	Het
Hps5	T	C	7: 46,789,196	T38A	probably damaging	Het
Hs1bp3	A	G	12: 8,341,843	D315G	possibly damaging	Het
Kdm4a	C	T	4: 118,138,876	M985I	probably damaging	Het
Kdm5d	A	G	Y: 900,525	Y190C	probably damaging	Het
Krt86	T	C	15: 101,476,610	S295P	probably damaging	Het
Matr3	T	A	18: 35,587,738	D413E	probably benign	Het
Mbd5	T	A	2: 49,274,645	F319L	probably damaging	Het
Mcoln1	T	A	8: 3,510,910	Y411N	probably damaging	Het
Mrps9	A	G	1: 42,895,378	E173G	probably damaging	Het
Olfr8	A	T	10: 78,955,357	I51F	probably benign	Het
Osmr	T	C	15: 6,821,047	T692A	probably benign	Het
Pkhd1l1	A	T	15: 44,578,588	H3641L	possibly damaging	Het
Pml	T	C	9: 58,233,182	T421A	possibly damaging	Het
Podxl	A	G	6: 31,528,456		probably null	Het
Ppargc1b	C	G	18: 61,309,093	D591H	probably damaging	Het
Prkag3	A	G	1: 74,748,816		probably benign	Het
Proz	A	G	8: 13,073,448	R240G	probably benign	Het
Ptpn13	C	A	5: 103,476,960	D43E	probably damaging	Het
Rbm5	T	G	9: 107,760,326	K135N	probably damaging	Het
Ska1	G	A	18: 74,197,528	T201M	probably damaging	Het
Slc35f5	A	C	1: 125,587,363		probably null	Het
Slc9a3	T	C	13: 74,161,723	L510P	probably damaging	Het
Svil	A	G	18: 5,082,828	K1231E	probably damaging	Het
Tanc2	T	C	11: 105,922,613	S1628P	possibly damaging	Het
Tm9sf3	T	A	19: 41,240,584	D260V	probably damaging	Het
Ttc9	G	T	12: 81,631,622	R73L	probably damaging	Het
Vps13b	A	G	15: 35,917,061	I3684V	probably damaging	Het
Vps8	T	C	16: 21,461,439		probably null	Het
Vwa3b	T	A	1: 37,076,439	I328N	probably damaging	Het
Wdr1	C	T	5: 38,530,023	V222M	probably benign	Het
Xpnpep1	T	A	19: 52,997,008	T530S	probably damaging	Het
Zc3h6	C	T	2: 128,993,277	S111F	probably benign	Het
Zfp768	G	A	7: 127,344,546	P137S	probably benign	Het

Other mutations in Mpdz

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Mpdz	APN	4	81310224	nonsense	probably null
IGL00325:Mpdz	APN	4	81317631	missense	probably damaging	1.00
IGL00497:Mpdz	APN	4	81335742	missense	probably benign	0.30
IGL00502:Mpdz	APN	4	81369723	missense	probably damaging	1.00
IGL00539:Mpdz	APN	4	81361351	missense	possibly damaging	0.83
IGL00938:Mpdz	APN	4	81292512	missense	probably damaging	1.00
IGL00990:Mpdz	APN	4	81303584	splice site	probably benign
IGL01394:Mpdz	APN	4	81292491	missense	possibly damaging	0.92
IGL01537:Mpdz	APN	4	81369658	missense	probably damaging	0.98
IGL01558:Mpdz	APN	4	81295530	nonsense	probably null
IGL01561:Mpdz	APN	4	81284614	missense	probably damaging	1.00
IGL01649:Mpdz	APN	4	81303633	missense	probably damaging	0.98
IGL01743:Mpdz	APN	4	81317682	missense	probably damaging	1.00
IGL01941:Mpdz	APN	4	81286387	missense	possibly damaging	0.91
IGL01969:Mpdz	APN	4	81358724	missense	probably damaging	0.98
IGL02023:Mpdz	APN	4	81329529	missense	probably damaging	0.99
IGL02081:Mpdz	APN	4	81335869	missense	probably damaging	1.00
IGL02304:Mpdz	APN	4	81310157	missense	possibly damaging	0.78
IGL02304:Mpdz	APN	4	81297559	splice site	probably benign
IGL02410:Mpdz	APN	4	81297493	missense	probably benign	0.13
IGL02449:Mpdz	APN	4	81329422	splice site	probably null
IGL02671:Mpdz	APN	4	81290273	missense	probably damaging	1.00
IGL02708:Mpdz	APN	4	81284571	splice site	probably null
IGL02718:Mpdz	APN	4	81385202	missense	probably damaging	1.00
IGL03065:Mpdz	APN	4	81292565	missense	probably damaging	0.98
IGL03378:Mpdz	APN	4	81419048	splice site	probably benign
PIT4458001:Mpdz	UTSW	4	81419026	missense	probably damaging	1.00
R0108:Mpdz	UTSW	4	81381805	missense	probably damaging	1.00
R0108:Mpdz	UTSW	4	81381805	missense	probably damaging	1.00
R0119:Mpdz	UTSW	4	81292531	missense	probably benign	0.44
R0402:Mpdz	UTSW	4	81361440	missense	possibly damaging	0.51
R0499:Mpdz	UTSW	4	81292531	missense	probably benign	0.44
R0718:Mpdz	UTSW	4	81292473	missense	possibly damaging	0.79
R0844:Mpdz	UTSW	4	81421194	start gained	probably benign
R0883:Mpdz	UTSW	4	81359991	splice site	probably benign
R0885:Mpdz	UTSW	4	81369592	missense	probably benign	0.04
R1344:Mpdz	UTSW	4	81308319	missense	probably benign	0.01
R1432:Mpdz	UTSW	4	81292551	missense	probably damaging	1.00
R1488:Mpdz	UTSW	4	81348708	nonsense	probably null
R1589:Mpdz	UTSW	4	81421176	missense	probably benign	0.00
R1756:Mpdz	UTSW	4	81306877	missense	possibly damaging	0.87
R1940:Mpdz	UTSW	4	81361443	missense	probably benign	0.01
R2068:Mpdz	UTSW	4	81335830	missense	probably null	1.00
R2182:Mpdz	UTSW	4	81348722	missense	probably damaging	1.00
R2213:Mpdz	UTSW	4	81310172	missense	probably damaging	0.99
R2265:Mpdz	UTSW	4	81383391	missense	probably damaging	1.00
R2268:Mpdz	UTSW	4	81383391	missense	probably damaging	1.00
R2269:Mpdz	UTSW	4	81383391	missense	probably damaging	1.00
R3082:Mpdz	UTSW	4	81285458	splice site	probably benign
R3746:Mpdz	UTSW	4	81363147	missense	probably damaging	1.00
R3902:Mpdz	UTSW	4	81307116	missense	probably damaging	1.00
R4095:Mpdz	UTSW	4	81383823	missense	possibly damaging	0.77
R4097:Mpdz	UTSW	4	81335700	missense	probably damaging	1.00
R4206:Mpdz	UTSW	4	81381762	missense	probably benign	0.13
R4675:Mpdz	UTSW	4	81383812	missense	probably damaging	0.98
R4884:Mpdz	UTSW	4	81361476	missense	probably damaging	0.97
R5044:Mpdz	UTSW	4	81381697	missense	probably benign	0.16
R5050:Mpdz	UTSW	4	81295448	missense	probably benign	0.00
R5243:Mpdz	UTSW	4	81306879	missense	probably damaging	1.00
R5332:Mpdz	UTSW	4	81292580	missense	probably damaging	1.00
R5435:Mpdz	UTSW	4	81283487	intron	probably benign
R5720:Mpdz	UTSW	4	81287694	missense	probably damaging	0.99
R5743:Mpdz	UTSW	4	81421188	start codon destroyed	probably null	0.30
R5764:Mpdz	UTSW	4	81356446	missense	probably benign	0.13
R5938:Mpdz	UTSW	4	81284614	missense	probably damaging	1.00
R5988:Mpdz	UTSW	4	81284575	critical splice donor site	probably null
R6125:Mpdz	UTSW	4	81297527	missense	probably benign	0.00
R6178:Mpdz	UTSW	4	81308365	missense	probably damaging	1.00
R6235:Mpdz	UTSW	4	81385281	missense	probably damaging	1.00
R6293:Mpdz	UTSW	4	81360056	missense	probably damaging	1.00
R6387:Mpdz	UTSW	4	81381709	missense	possibly damaging	0.69
R6488:Mpdz	UTSW	4	81287733	missense	probably benign	0.11
R6536:Mpdz	UTSW	4	81383417	missense	probably damaging	1.00
R6673:Mpdz	UTSW	4	81356430	missense	probably benign	0.11
R6879:Mpdz	UTSW	4	81348656	missense	possibly damaging	0.81
R7180:Mpdz	UTSW	4	81335751	missense	probably damaging	0.98
R7199:Mpdz	UTSW	4	81297333	missense	probably damaging	0.98
R7209:Mpdz	UTSW	4	81306877	missense	possibly damaging	0.87
R7309:Mpdz	UTSW	4	81381958	splice site	probably null
R7359:Mpdz	UTSW	4	81356395	missense	probably benign	0.01
R7561:Mpdz	UTSW	4	81307151	missense	probably damaging	0.99
R7565:Mpdz	UTSW	4	81303654	missense	probably benign	0.01
R7738:Mpdz	UTSW	4	81335749	missense	probably benign	0.01
R7941:Mpdz	UTSW	4	81282750	missense	probably benign	0.04
R8074:Mpdz	UTSW	4	81349087	missense	probably benign	0.00
R8957:Mpdz	UTSW	4	81332979	nonsense	probably null
R8998:Mpdz	UTSW	4	81284645	nonsense	probably null
R8999:Mpdz	UTSW	4	81284645	nonsense	probably null
R9001:Mpdz	UTSW	4	81381762	missense	probably benign
R9223:Mpdz	UTSW	4	81284630	missense	probably damaging	1.00
R9415:Mpdz	UTSW	4	81317668	nonsense	probably null
R9486:Mpdz	UTSW	4	81335806	missense	probably damaging	1.00
R9520:Mpdz	UTSW	4	81386318	missense	probably benign
R9526:Mpdz	UTSW	4	81356416	missense	probably benign
R9556:Mpdz	UTSW	4	81360026	missense	probably damaging	1.00
R9722:Mpdz	UTSW	4	81386267	missense	probably damaging	0.97
RF013:Mpdz	UTSW	4	81293592	missense	possibly damaging	0.60
X0011:Mpdz	UTSW	4	81292759	critical splice donor site	probably null
Z1177:Mpdz	UTSW	4	81320490	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GAGAATCATTCTGTGTAAGGGCAG -3'
(R):5'- GGAAGAACTGTATGGCATGCAC -3'

Sequencing Primer
(F):5'- CAATGACAGAACTGCGCT -3'
(R):5'- GAACTGTATGGCATGCACATTTTTC -3'

Posted On

2017-02-10