Incidental Mutation 'R5876:Kdm4a'
ID455519
Institutional Source Beutler Lab
Gene Symbol Kdm4a
Ensembl Gene ENSMUSG00000033326
Gene Namelysine (K)-specific demethylase 4A
SynonymsJmjd2, D4Ertd222e, JHDM3A, Jmjd2a
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.658) question?
Stock #R5876 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location118136957-118180043 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 118138876 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 985 (M985I)
Ref Sequence ENSEMBL: ENSMUSP00000102014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030263] [ENSMUST00000050288] [ENSMUST00000097911] [ENSMUST00000097912] [ENSMUST00000106403] [ENSMUST00000106406] [ENSMUST00000106410]
Predicted Effect probably benign
Transcript: ENSMUST00000030263
SMART Domains Protein: ENSMUSP00000030263
Gene: ENSMUSG00000028538

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 37 47 N/A INTRINSIC
Pfam:Glyco_transf_29 102 373 5.7e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050288
SMART Domains Protein: ENSMUSP00000062910
Gene: ENSMUSG00000033326

DomainStartEndE-ValueType
JmjN 13 55 1.01e-20 SMART
JmjC 142 308 3.57e-63 SMART
low complexity region 461 487 N/A INTRINSIC
low complexity region 502 525 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
PHD 709 767 4.93e-4 SMART
PHD 829 885 1.54e-5 SMART
TUDOR 897 954 2.87e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097911
AA Change: M985I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095524
Gene: ENSMUSG00000033326
AA Change: M985I

DomainStartEndE-ValueType
JmjN 13 55 1.01e-20 SMART
JmjC 142 308 3.57e-63 SMART
low complexity region 461 487 N/A INTRINSIC
low complexity region 502 525 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
PHD 709 767 4.93e-4 SMART
PHD 829 885 1.54e-5 SMART
TUDOR 897 954 2.41e-10 SMART
TUDOR 955 1011 4.77e-14 SMART
low complexity region 1032 1044 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097912
SMART Domains Protein: ENSMUSP00000095525
Gene: ENSMUSG00000028538

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 86 357 5.4e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106403
AA Change: M985I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102011
Gene: ENSMUSG00000033326
AA Change: M985I

DomainStartEndE-ValueType
JmjN 13 55 1.01e-20 SMART
JmjC 142 308 3.57e-63 SMART
low complexity region 461 487 N/A INTRINSIC
low complexity region 502 525 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
PHD 709 767 4.93e-4 SMART
PHD 829 885 1.54e-5 SMART
TUDOR 897 954 2.41e-10 SMART
TUDOR 955 1011 4.77e-14 SMART
low complexity region 1032 1044 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106406
AA Change: M985I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102014
Gene: ENSMUSG00000033326
AA Change: M985I

DomainStartEndE-ValueType
JmjN 13 55 1.01e-20 SMART
JmjC 142 308 3.57e-63 SMART
low complexity region 461 487 N/A INTRINSIC
low complexity region 502 525 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
PHD 709 767 4.93e-4 SMART
PHD 829 885 1.54e-5 SMART
TUDOR 897 954 2.41e-10 SMART
TUDOR 955 1011 4.77e-14 SMART
low complexity region 1032 1044 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106410
SMART Domains Protein: ENSMUSP00000102018
Gene: ENSMUSG00000028538

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 37 47 N/A INTRINSIC
Pfam:Glyco_transf_29 106 372 4.7e-63 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Jumonji domain 2 (JMJD2) family and encodes a protein containing a JmjN domain, a JmjC domain, a JD2H domain, two TUDOR domains, and two PHD-type zinc fingers. This nuclear protein functions as a trimethylation-specific demethylase, converting specific trimethylated histone residues to the dimethylated form, and as a transcriptional repressor. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,663,582 D64G possibly damaging Het
Ano2 T A 6: 126,039,279 M925K possibly damaging Het
Arnt2 T C 7: 84,347,512 T69A probably damaging Het
Asap2 T A 12: 21,212,809 N229K possibly damaging Het
Atp13a3 T A 16: 30,362,734 N23Y probably benign Het
Cbr4 G A 8: 61,490,593 G91R possibly damaging Het
Cdc27 A T 11: 104,515,418 C624S probably benign Het
Cdc42bpg T A 19: 6,310,815 I201N probably damaging Het
Cdh5 A G 8: 104,142,577 Y645C probably damaging Het
Celsr2 C T 3: 108,413,943 V518I probably damaging Het
Clca4b T C 3: 144,912,060 T761A possibly damaging Het
Cpne4 C A 9: 104,925,770 S204R probably damaging Het
Dcaf1 T C 9: 106,863,650 W1279R probably damaging Het
Dennd4a C T 9: 64,911,755 P1731S probably damaging Het
Dmxl1 T A 18: 49,870,984 V892D possibly damaging Het
Fam131b A G 6: 42,321,248 probably null Het
Fam83b T A 9: 76,491,850 D657V possibly damaging Het
Fam83e T A 7: 45,722,363 probably null Het
Fbxo4 A T 15: 3,977,819 I121N probably damaging Het
Gabrg2 A G 11: 41,968,820 S202P probably damaging Het
Gm10471 T C 5: 26,084,718 E237G probably damaging Het
Grid2 T A 6: 64,663,162 I788N probably damaging Het
Grik4 T A 9: 42,688,023 N53Y probably damaging Het
Hipk2 A C 6: 38,730,867 probably null Het
Hps5 T C 7: 46,789,196 T38A probably damaging Het
Hs1bp3 A G 12: 8,341,843 D315G possibly damaging Het
Kdm5d A G Y: 900,525 Y190C probably damaging Het
Krt86 T C 15: 101,476,610 S295P probably damaging Het
Matr3 T A 18: 35,587,738 D413E probably benign Het
Mbd5 T A 2: 49,274,645 F319L probably damaging Het
Mcoln1 T A 8: 3,510,910 Y411N probably damaging Het
Mpdz C A 4: 81,285,474 E1863* probably null Het
Mrps9 A G 1: 42,895,378 E173G probably damaging Het
Olfr8 A T 10: 78,955,357 I51F probably benign Het
Osmr T C 15: 6,821,047 T692A probably benign Het
Pkhd1l1 A T 15: 44,578,588 H3641L possibly damaging Het
Pml T C 9: 58,233,182 T421A possibly damaging Het
Podxl A G 6: 31,528,456 probably null Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prkag3 A G 1: 74,748,816 probably benign Het
Proz A G 8: 13,073,448 R240G probably benign Het
Ptpn13 C A 5: 103,476,960 D43E probably damaging Het
Rbm5 T G 9: 107,760,326 K135N probably damaging Het
Ska1 G A 18: 74,197,528 T201M probably damaging Het
Slc35f5 A C 1: 125,587,363 probably null Het
Slc9a3 T C 13: 74,161,723 L510P probably damaging Het
Svil A G 18: 5,082,828 K1231E probably damaging Het
Tanc2 T C 11: 105,922,613 S1628P possibly damaging Het
Tm9sf3 T A 19: 41,240,584 D260V probably damaging Het
Ttc9 G T 12: 81,631,622 R73L probably damaging Het
Vps13b A G 15: 35,917,061 I3684V probably damaging Het
Vps8 T C 16: 21,461,439 probably null Het
Vwa3b T A 1: 37,076,439 I328N probably damaging Het
Wdr1 C T 5: 38,530,023 V222M probably benign Het
Xpnpep1 T A 19: 52,997,008 T530S probably damaging Het
Zc3h6 C T 2: 128,993,277 S111F probably benign Het
Zfp768 G A 7: 127,344,546 P137S probably benign Het
Other mutations in Kdm4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Kdm4a APN 4 118160501 missense probably damaging 1.00
IGL01845:Kdm4a APN 4 118160459 missense possibly damaging 0.85
IGL02009:Kdm4a APN 4 118160169 missense probably benign 0.01
IGL02296:Kdm4a APN 4 118177465 missense probably damaging 1.00
IGL02366:Kdm4a APN 4 118160506 critical splice acceptor site probably null
IGL02606:Kdm4a APN 4 118160289 missense probably benign 0.00
IGL02673:Kdm4a APN 4 118168572 missense probably benign 0.00
R0245:Kdm4a UTSW 4 118175689 missense probably benign 0.05
R0326:Kdm4a UTSW 4 118161706 missense probably benign 0.00
R0551:Kdm4a UTSW 4 118138231 makesense probably null
R0603:Kdm4a UTSW 4 118142511 missense probably damaging 1.00
R0652:Kdm4a UTSW 4 118175689 missense probably benign 0.05
R0799:Kdm4a UTSW 4 118146992 splice site probably null
R0847:Kdm4a UTSW 4 118164498 missense probably damaging 0.96
R1307:Kdm4a UTSW 4 118175642 missense probably benign 0.02
R1572:Kdm4a UTSW 4 118138949 missense possibly damaging 0.89
R1869:Kdm4a UTSW 4 118138871 missense probably null 1.00
R1902:Kdm4a UTSW 4 118160399 missense probably benign 0.38
R1903:Kdm4a UTSW 4 118160399 missense probably benign 0.38
R2135:Kdm4a UTSW 4 118142459 missense probably damaging 1.00
R3856:Kdm4a UTSW 4 118153231 missense probably damaging 1.00
R4687:Kdm4a UTSW 4 118144083 missense probably damaging 1.00
R4940:Kdm4a UTSW 4 118161754 missense probably benign 0.00
R5115:Kdm4a UTSW 4 118162581 missense possibly damaging 0.75
R5229:Kdm4a UTSW 4 118146605 missense probably damaging 0.99
R5305:Kdm4a UTSW 4 118160501 missense probably damaging 1.00
R5423:Kdm4a UTSW 4 118138908 missense probably damaging 1.00
R5750:Kdm4a UTSW 4 118142199 intron probably benign
R5849:Kdm4a UTSW 4 118161840 missense probably benign 0.17
R6564:Kdm4a UTSW 4 118177439 missense probably benign 0.18
R6772:Kdm4a UTSW 4 118142555 critical splice acceptor site probably null
R6982:Kdm4a UTSW 4 118153439 splice site probably null
R7410:Kdm4a UTSW 4 118143918 missense possibly damaging 0.64
R7418:Kdm4a UTSW 4 118160243 missense probably damaging 0.99
Z1176:Kdm4a UTSW 4 118153190 missense probably benign 0.00
Z1176:Kdm4a UTSW 4 118177502 missense probably benign 0.41
Z1177:Kdm4a UTSW 4 118147169 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCGGTAGTAAGGACTTTCCATG -3'
(R):5'- AGTCCTTCCTGAGTCATTGGC -3'

Sequencing Primer
(F):5'- CTTTCCATGTAAGGAATGACGGCC -3'
(R):5'- CCTGAGTCATTGGCACTTAGC -3'
Posted On2017-02-10