Incidental Mutation 'R5876:Wdr1'
ID455521
Institutional Source Beutler Lab
Gene Symbol Wdr1
Ensembl Gene ENSMUSG00000005103
Gene NameWD repeat domain 1
SynonymsAip1, rede, D5Wsu185e
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5876 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location38526813-38563221 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 38530023 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 222 (V222M)
Ref Sequence ENSEMBL: ENSMUSP00000143937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005234] [ENSMUST00000201260]
Predicted Effect probably benign
Transcript: ENSMUST00000005234
AA Change: V495M

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000005234
Gene: ENSMUSG00000005103
AA Change: V495M

DomainStartEndE-ValueType
WD40 47 86 1.7e-2 SMART
WD40 91 134 5.52e0 SMART
WD40 135 175 3.69e-3 SMART
WD40 178 217 4.4e-10 SMART
WD40 220 262 1.74e-8 SMART
WD40 309 350 7.05e-9 SMART
WD40 354 392 6.9e-1 SMART
WD40 434 473 1.36e-1 SMART
WD40 478 517 7.8e-2 SMART
WD40 521 560 1.83e-7 SMART
WD40 564 603 3.71e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201059
Predicted Effect probably benign
Transcript: ENSMUST00000201260
AA Change: V222M

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000143937
Gene: ENSMUSG00000005103
AA Change: V222M

DomainStartEndE-ValueType
WD40 36 77 4.6e-11 SMART
WD40 81 119 4.5e-3 SMART
WD40 161 200 8.9e-4 SMART
WD40 205 244 4.9e-4 SMART
WD40 248 287 1.2e-9 SMART
WD40 291 330 2.4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202496
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing 9 WD repeats. WD repeats are approximately 30- to 40-amino acid domains containing several conserved residues, mostly including a trp-asp at the C-terminal end. WD domains are involved in protein-protein interactions. The encoded protein may help induce the disassembly of actin filaments. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Severe loss of function at this locus causes embryonic lethality. Mice homozygous for a hypomorphic ENU-induced allele exhibit thrombocytopenia due to impaired megakaryocyte maturation and platelet shedding, and develop autoinflammatory disease associated with defects in neutrophil function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,663,582 D64G possibly damaging Het
Ano2 T A 6: 126,039,279 M925K possibly damaging Het
Arnt2 T C 7: 84,347,512 T69A probably damaging Het
Asap2 T A 12: 21,212,809 N229K possibly damaging Het
Atp13a3 T A 16: 30,362,734 N23Y probably benign Het
Cbr4 G A 8: 61,490,593 G91R possibly damaging Het
Cdc27 A T 11: 104,515,418 C624S probably benign Het
Cdc42bpg T A 19: 6,310,815 I201N probably damaging Het
Cdh5 A G 8: 104,142,577 Y645C probably damaging Het
Celsr2 C T 3: 108,413,943 V518I probably damaging Het
Clca4b T C 3: 144,912,060 T761A possibly damaging Het
Cpne4 C A 9: 104,925,770 S204R probably damaging Het
Dcaf1 T C 9: 106,863,650 W1279R probably damaging Het
Dennd4a C T 9: 64,911,755 P1731S probably damaging Het
Dmxl1 T A 18: 49,870,984 V892D possibly damaging Het
Fam131b A G 6: 42,321,248 probably null Het
Fam83b T A 9: 76,491,850 D657V possibly damaging Het
Fam83e T A 7: 45,722,363 probably null Het
Fbxo4 A T 15: 3,977,819 I121N probably damaging Het
Gabrg2 A G 11: 41,968,820 S202P probably damaging Het
Gm10471 T C 5: 26,084,718 E237G probably damaging Het
Grid2 T A 6: 64,663,162 I788N probably damaging Het
Grik4 T A 9: 42,688,023 N53Y probably damaging Het
Hipk2 A C 6: 38,730,867 probably null Het
Hps5 T C 7: 46,789,196 T38A probably damaging Het
Hs1bp3 A G 12: 8,341,843 D315G possibly damaging Het
Kdm4a C T 4: 118,138,876 M985I probably damaging Het
Kdm5d A G Y: 900,525 Y190C probably damaging Het
Krt86 T C 15: 101,476,610 S295P probably damaging Het
Matr3 T A 18: 35,587,738 D413E probably benign Het
Mbd5 T A 2: 49,274,645 F319L probably damaging Het
Mcoln1 T A 8: 3,510,910 Y411N probably damaging Het
Mpdz C A 4: 81,285,474 E1863* probably null Het
Mrps9 A G 1: 42,895,378 E173G probably damaging Het
Olfr8 A T 10: 78,955,357 I51F probably benign Het
Osmr T C 15: 6,821,047 T692A probably benign Het
Pkhd1l1 A T 15: 44,578,588 H3641L possibly damaging Het
Pml T C 9: 58,233,182 T421A possibly damaging Het
Podxl A G 6: 31,528,456 probably null Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prkag3 A G 1: 74,748,816 probably benign Het
Proz A G 8: 13,073,448 R240G probably benign Het
Ptpn13 C A 5: 103,476,960 D43E probably damaging Het
Rbm5 T G 9: 107,760,326 K135N probably damaging Het
Ska1 G A 18: 74,197,528 T201M probably damaging Het
Slc35f5 A C 1: 125,587,363 probably null Het
Slc9a3 T C 13: 74,161,723 L510P probably damaging Het
Svil A G 18: 5,082,828 K1231E probably damaging Het
Tanc2 T C 11: 105,922,613 S1628P possibly damaging Het
Tm9sf3 T A 19: 41,240,584 D260V probably damaging Het
Ttc9 G T 12: 81,631,622 R73L probably damaging Het
Vps13b A G 15: 35,917,061 I3684V probably damaging Het
Vps8 T C 16: 21,461,439 probably null Het
Vwa3b T A 1: 37,076,439 I328N probably damaging Het
Xpnpep1 T A 19: 52,997,008 T530S probably damaging Het
Zc3h6 C T 2: 128,993,277 S111F probably benign Het
Zfp768 G A 7: 127,344,546 P137S probably benign Het
Other mutations in Wdr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00939:Wdr1 APN 5 38535323 missense probably benign 0.00
IGL01071:Wdr1 APN 5 38530067 missense probably benign 0.14
IGL01293:Wdr1 APN 5 38529543 missense probably benign 0.00
IGL01347:Wdr1 APN 5 38545715 missense possibly damaging 0.77
IGL01532:Wdr1 APN 5 38535187 missense probably damaging 1.00
IGL02409:Wdr1 APN 5 38531110 missense probably benign 0.06
IGL02415:Wdr1 APN 5 38531110 missense probably damaging 1.00
IGL02543:Wdr1 APN 5 38545822 missense probably damaging 1.00
IGL02550:Wdr1 APN 5 38540863 missense probably damaging 1.00
IGL03093:Wdr1 APN 5 38561129 missense probably benign 0.01
IGL03183:Wdr1 APN 5 38533482 critical splice donor site probably null
R0724:Wdr1 UTSW 5 38540862 missense possibly damaging 0.87
R1509:Wdr1 UTSW 5 38540562 missense probably damaging 0.96
R1589:Wdr1 UTSW 5 38529972 missense probably benign 0.43
R3039:Wdr1 UTSW 5 38530085 missense possibly damaging 0.94
R3767:Wdr1 UTSW 5 38540539 missense probably damaging 1.00
R4833:Wdr1 UTSW 5 38547029 missense probably damaging 1.00
R5405:Wdr1 UTSW 5 38535200 missense probably benign 0.03
R5475:Wdr1 UTSW 5 38529588 missense probably damaging 1.00
R5476:Wdr1 UTSW 5 38529588 missense probably damaging 1.00
R5619:Wdr1 UTSW 5 38529536 missense possibly damaging 0.93
R5852:Wdr1 UTSW 5 38537175 missense probably benign 0.00
R6170:Wdr1 UTSW 5 38529671 critical splice acceptor site probably null
R6367:Wdr1 UTSW 5 38545846 missense possibly damaging 0.68
R6524:Wdr1 UTSW 5 38530063 missense probably benign 0.07
R6643:Wdr1 UTSW 5 38540178 missense probably damaging 1.00
R6838:Wdr1 UTSW 5 38530031 missense probably damaging 0.96
R7305:Wdr1 UTSW 5 38540092 missense possibly damaging 0.90
R8364:Wdr1 UTSW 5 38527849 missense possibly damaging 0.80
R8380:Wdr1 UTSW 5 38540521 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCCGCTCATGAAGATGAAGAC -3'
(R):5'- ACGTACTGGTGCCTACTGAG -3'

Sequencing Primer
(F):5'- CTCATGAAGATGAAGACATGGCTG -3'
(R):5'- TACTGGTGCCTACTGAGCCATG -3'
Posted On2017-02-10