Incidental Mutation 'R5876:Fam83e'
ID455528
Institutional Source Beutler Lab
Gene Symbol Fam83e
Ensembl Gene ENSMUSG00000054161
Gene Namefamily with sequence similarity 83, member E
Synonyms4930403C10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5876 (G1)
Quality Score103
Status Not validated
Chromosome7
Chromosomal Location45721212-45729492 bp(+) (GRCm38)
Type of Mutationunclassified (2744 bp from exon)
DNA Base Change (assembly) T to A at 45722363 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072503] [ENSMUST00000094424] [ENSMUST00000107737] [ENSMUST00000129507] [ENSMUST00000209287] [ENSMUST00000209693] [ENSMUST00000210060] [ENSMUST00000210640] [ENSMUST00000211061] [ENSMUST00000211435]
Predicted Effect probably benign
Transcript: ENSMUST00000072503
SMART Domains Protein: ENSMUSP00000072320
Gene: ENSMUSG00000059070

DomainStartEndE-ValueType
PDB:2ZKR|O 1 188 1e-116 PDB
SCOP:d1jj2n_ 22 139 1e-43 SMART
Predicted Effect probably null
Transcript: ENSMUST00000094424
SMART Domains Protein: ENSMUSP00000091991
Gene: ENSMUSG00000070563

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:UPAR_LY6 23 97 1.7e-7 PFAM
low complexity region 99 123 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107737
SMART Domains Protein: ENSMUSP00000103366
Gene: ENSMUSG00000057342

DomainStartEndE-ValueType
SCOP:d1epfa2 63 87 1e-2 SMART
DAGKc 147 284 4.49e-5 SMART
low complexity region 369 376 N/A INTRINSIC
low complexity region 429 440 N/A INTRINSIC
PDB:3VZB|C 468 609 4e-25 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000129507
AA Change: F61L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114397
Gene: ENSMUSG00000054161
AA Change: F61L

DomainStartEndE-ValueType
Pfam:DUF1669 18 293 4.8e-105 PFAM
low complexity region 371 385 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156689
AA Change: S382T
Predicted Effect probably benign
Transcript: ENSMUST00000209287
Predicted Effect probably benign
Transcript: ENSMUST00000209556
Predicted Effect probably benign
Transcript: ENSMUST00000209693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209723
Predicted Effect probably benign
Transcript: ENSMUST00000209867
Predicted Effect probably benign
Transcript: ENSMUST00000210060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210434
Predicted Effect probably benign
Transcript: ENSMUST00000210640
Predicted Effect probably benign
Transcript: ENSMUST00000211061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211425
Predicted Effect probably benign
Transcript: ENSMUST00000211435
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,663,582 D64G possibly damaging Het
Ano2 T A 6: 126,039,279 M925K possibly damaging Het
Arnt2 T C 7: 84,347,512 T69A probably damaging Het
Asap2 T A 12: 21,212,809 N229K possibly damaging Het
Atp13a3 T A 16: 30,362,734 N23Y probably benign Het
Cbr4 G A 8: 61,490,593 G91R possibly damaging Het
Cdc27 A T 11: 104,515,418 C624S probably benign Het
Cdc42bpg T A 19: 6,310,815 I201N probably damaging Het
Cdh5 A G 8: 104,142,577 Y645C probably damaging Het
Celsr2 C T 3: 108,413,943 V518I probably damaging Het
Clca4b T C 3: 144,912,060 T761A possibly damaging Het
Cpne4 C A 9: 104,925,770 S204R probably damaging Het
Dcaf1 T C 9: 106,863,650 W1279R probably damaging Het
Dennd4a C T 9: 64,911,755 P1731S probably damaging Het
Dmxl1 T A 18: 49,870,984 V892D possibly damaging Het
Fam131b A G 6: 42,321,248 probably null Het
Fam83b T A 9: 76,491,850 D657V possibly damaging Het
Fbxo4 A T 15: 3,977,819 I121N probably damaging Het
Gabrg2 A G 11: 41,968,820 S202P probably damaging Het
Gm10471 T C 5: 26,084,718 E237G probably damaging Het
Grid2 T A 6: 64,663,162 I788N probably damaging Het
Grik4 T A 9: 42,688,023 N53Y probably damaging Het
Hipk2 A C 6: 38,730,867 probably null Het
Hps5 T C 7: 46,789,196 T38A probably damaging Het
Hs1bp3 A G 12: 8,341,843 D315G possibly damaging Het
Kdm4a C T 4: 118,138,876 M985I probably damaging Het
Kdm5d A G Y: 900,525 Y190C probably damaging Het
Krt86 T C 15: 101,476,610 S295P probably damaging Het
Matr3 T A 18: 35,587,738 D413E probably benign Het
Mbd5 T A 2: 49,274,645 F319L probably damaging Het
Mcoln1 T A 8: 3,510,910 Y411N probably damaging Het
Mpdz C A 4: 81,285,474 E1863* probably null Het
Mrps9 A G 1: 42,895,378 E173G probably damaging Het
Olfr8 A T 10: 78,955,357 I51F probably benign Het
Osmr T C 15: 6,821,047 T692A probably benign Het
Pkhd1l1 A T 15: 44,578,588 H3641L possibly damaging Het
Pml T C 9: 58,233,182 T421A possibly damaging Het
Podxl A G 6: 31,528,456 probably null Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prkag3 A G 1: 74,748,816 probably benign Het
Proz A G 8: 13,073,448 R240G probably benign Het
Ptpn13 C A 5: 103,476,960 D43E probably damaging Het
Rbm5 T G 9: 107,760,326 K135N probably damaging Het
Ska1 G A 18: 74,197,528 T201M probably damaging Het
Slc35f5 A C 1: 125,587,363 probably null Het
Slc9a3 T C 13: 74,161,723 L510P probably damaging Het
Svil A G 18: 5,082,828 K1231E probably damaging Het
Tanc2 T C 11: 105,922,613 S1628P possibly damaging Het
Tm9sf3 T A 19: 41,240,584 D260V probably damaging Het
Ttc9 G T 12: 81,631,622 R73L probably damaging Het
Vps13b A G 15: 35,917,061 I3684V probably damaging Het
Vps8 T C 16: 21,461,439 probably null Het
Vwa3b T A 1: 37,076,439 I328N probably damaging Het
Wdr1 C T 5: 38,530,023 V222M probably benign Het
Xpnpep1 T A 19: 52,997,008 T530S probably damaging Het
Zc3h6 C T 2: 128,993,277 S111F probably benign Het
Zfp768 G A 7: 127,344,546 P137S probably benign Het
Other mutations in Fam83e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Fam83e APN 7 45727069 missense probably benign 0.12
IGL01590:Fam83e APN 7 45723936 missense probably null 1.00
IGL02334:Fam83e APN 7 45723921 missense probably benign 0.00
IGL03155:Fam83e APN 7 45727075 missense possibly damaging 0.90
IGL03276:Fam83e APN 7 45723460 missense possibly damaging 0.72
R0268:Fam83e UTSW 7 45726910 missense probably benign
R0362:Fam83e UTSW 7 45726969 missense probably benign 0.40
R0453:Fam83e UTSW 7 45723948 missense probably damaging 1.00
R0832:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R0870:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R0871:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R1415:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R1574:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R1574:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R1656:Fam83e UTSW 7 45722263 missense probably benign
R1848:Fam83e UTSW 7 45728769 nonsense probably null
R1848:Fam83e UTSW 7 45728770 missense possibly damaging 0.79
R2189:Fam83e UTSW 7 45722183 start codon destroyed probably null 0.88
R2256:Fam83e UTSW 7 45728769 nonsense probably null
R2256:Fam83e UTSW 7 45728770 missense possibly damaging 0.79
R2257:Fam83e UTSW 7 45728769 nonsense probably null
R2257:Fam83e UTSW 7 45728770 missense possibly damaging 0.79
R4376:Fam83e UTSW 7 45723893 missense probably damaging 1.00
R4600:Fam83e UTSW 7 45723500 missense probably benign 0.01
R6666:Fam83e UTSW 7 45727002 missense probably benign
R6766:Fam83e UTSW 7 45726646 missense probably damaging 1.00
R6781:Fam83e UTSW 7 45722147 unclassified probably benign
R6933:Fam83e UTSW 7 45722394 missense probably benign
R7320:Fam83e UTSW 7 45722472 missense probably benign 0.16
R7477:Fam83e UTSW 7 45728980 missense probably damaging 1.00
R7636:Fam83e UTSW 7 45727026 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCTATCTCCAAAAGCCATCTAG -3'
(R):5'- TTCCAGGCAGTGTCTTCAGG -3'

Sequencing Primer
(F):5'- TTTGAATGGCAGCCTCCCAG -3'
(R):5'- AGTGTCTTCAGGCCAGCCAAG -3'
Posted On2017-02-10