Incidental Mutation 'R5876:Hps5'
ID455529
Institutional Source Beutler Lab
Gene Symbol Hps5
Ensembl Gene ENSMUSG00000014418
Gene NameHPS5, biogenesis of lysosomal organelles complex 2 subunit 2
Synonymsru-2, ru2, ruby eye 2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R5876 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location46760466-46796064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46789196 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 38 (T38A)
Ref Sequence ENSEMBL: ENSMUSP00000116770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014562] [ENSMUST00000107653] [ENSMUST00000107654] [ENSMUST00000123725] [ENSMUST00000142663] [ENSMUST00000152759] [ENSMUST00000211347]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014562
AA Change: T38A

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000014562
Gene: ENSMUSG00000014418
AA Change: T38A

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 3e-8 SMART
Blast:WD40 63 103 7e-21 BLAST
Blast:WD40 111 151 1e-19 BLAST
low complexity region 429 449 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
low complexity region 989 998 N/A INTRINSIC
low complexity region 1021 1033 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107653
AA Change: T38A

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103280
Gene: ENSMUSG00000014418
AA Change: T38A

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 3e-8 SMART
Blast:WD40 63 103 6e-21 BLAST
Blast:WD40 111 151 1e-19 BLAST
low complexity region 396 416 N/A INTRINSIC
low complexity region 742 753 N/A INTRINSIC
low complexity region 956 965 N/A INTRINSIC
low complexity region 988 1000 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107654
AA Change: T38A

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103281
Gene: ENSMUSG00000014418
AA Change: T38A

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 3e-8 SMART
Blast:WD40 63 103 7e-21 BLAST
Blast:WD40 111 151 1e-19 BLAST
low complexity region 429 449 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
low complexity region 989 998 N/A INTRINSIC
low complexity region 1021 1033 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123725
AA Change: T38A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116770
Gene: ENSMUSG00000014418
AA Change: T38A

DomainStartEndE-ValueType
SCOP:d1tbga_ 24 107 5e-4 SMART
Blast:WD40 63 103 1e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124675
AA Change: Y55C
Predicted Effect possibly damaging
Transcript: ENSMUST00000142663
AA Change: T38A

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122887
Gene: ENSMUSG00000014418
AA Change: T38A

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 8e-8 SMART
Blast:WD40 63 103 9e-20 BLAST
Blast:WD40 111 151 2e-19 BLAST
low complexity region 429 449 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145776
Predicted Effect possibly damaging
Transcript: ENSMUST00000152759
AA Change: T38A

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115786
Gene: ENSMUSG00000014418
AA Change: T38A

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 2e-8 SMART
Blast:WD40 63 103 1e-21 BLAST
Blast:WD40 111 151 2e-20 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000211347
AA Change: T38A

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000211471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211528
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. This protein interacts with Hermansky-Pudlak syndrome 6 protein and may interact with the cytoplasmic domain of integrin, alpha-3. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 5. Multiple transcript variants encoding two distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes have hypopigmented eyes and hair, impaired secretion of lysosomal enzymes by renal proximal tubules and reduced clotting due to a platelet dense granule defect. Homozygotes for one allele are less susceptible to diet-induced atherosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,663,582 D64G possibly damaging Het
Ano2 T A 6: 126,039,279 M925K possibly damaging Het
Arnt2 T C 7: 84,347,512 T69A probably damaging Het
Asap2 T A 12: 21,212,809 N229K possibly damaging Het
Atp13a3 T A 16: 30,362,734 N23Y probably benign Het
Cbr4 G A 8: 61,490,593 G91R possibly damaging Het
Cdc27 A T 11: 104,515,418 C624S probably benign Het
Cdc42bpg T A 19: 6,310,815 I201N probably damaging Het
Cdh5 A G 8: 104,142,577 Y645C probably damaging Het
Celsr2 C T 3: 108,413,943 V518I probably damaging Het
Clca4b T C 3: 144,912,060 T761A possibly damaging Het
Cpne4 C A 9: 104,925,770 S204R probably damaging Het
Dcaf1 T C 9: 106,863,650 W1279R probably damaging Het
Dennd4a C T 9: 64,911,755 P1731S probably damaging Het
Dmxl1 T A 18: 49,870,984 V892D possibly damaging Het
Fam131b A G 6: 42,321,248 probably null Het
Fam83b T A 9: 76,491,850 D657V possibly damaging Het
Fam83e T A 7: 45,722,363 probably null Het
Fbxo4 A T 15: 3,977,819 I121N probably damaging Het
Gabrg2 A G 11: 41,968,820 S202P probably damaging Het
Gm10471 T C 5: 26,084,718 E237G probably damaging Het
Grid2 T A 6: 64,663,162 I788N probably damaging Het
Grik4 T A 9: 42,688,023 N53Y probably damaging Het
Hipk2 A C 6: 38,730,867 probably null Het
Hs1bp3 A G 12: 8,341,843 D315G possibly damaging Het
Kdm4a C T 4: 118,138,876 M985I probably damaging Het
Kdm5d A G Y: 900,525 Y190C probably damaging Het
Krt86 T C 15: 101,476,610 S295P probably damaging Het
Matr3 T A 18: 35,587,738 D413E probably benign Het
Mbd5 T A 2: 49,274,645 F319L probably damaging Het
Mcoln1 T A 8: 3,510,910 Y411N probably damaging Het
Mpdz C A 4: 81,285,474 E1863* probably null Het
Mrps9 A G 1: 42,895,378 E173G probably damaging Het
Olfr8 A T 10: 78,955,357 I51F probably benign Het
Osmr T C 15: 6,821,047 T692A probably benign Het
Pkhd1l1 A T 15: 44,578,588 H3641L possibly damaging Het
Pml T C 9: 58,233,182 T421A possibly damaging Het
Podxl A G 6: 31,528,456 probably null Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prkag3 A G 1: 74,748,816 probably benign Het
Proz A G 8: 13,073,448 R240G probably benign Het
Ptpn13 C A 5: 103,476,960 D43E probably damaging Het
Rbm5 T G 9: 107,760,326 K135N probably damaging Het
Ska1 G A 18: 74,197,528 T201M probably damaging Het
Slc35f5 A C 1: 125,587,363 probably null Het
Slc9a3 T C 13: 74,161,723 L510P probably damaging Het
Svil A G 18: 5,082,828 K1231E probably damaging Het
Tanc2 T C 11: 105,922,613 S1628P possibly damaging Het
Tm9sf3 T A 19: 41,240,584 D260V probably damaging Het
Ttc9 G T 12: 81,631,622 R73L probably damaging Het
Vps13b A G 15: 35,917,061 I3684V probably damaging Het
Vps8 T C 16: 21,461,439 probably null Het
Vwa3b T A 1: 37,076,439 I328N probably damaging Het
Wdr1 C T 5: 38,530,023 V222M probably benign Het
Xpnpep1 T A 19: 52,997,008 T530S probably damaging Het
Zc3h6 C T 2: 128,993,277 S111F probably benign Het
Zfp768 G A 7: 127,344,546 P137S probably benign Het
Other mutations in Hps5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hps5 APN 7 46775938 missense probably damaging 1.00
IGL00543:Hps5 APN 7 46778073 missense probably benign 0.37
IGL01090:Hps5 APN 7 46788327 missense probably benign 0.02
IGL01351:Hps5 APN 7 46761432 missense probably damaging 1.00
IGL01479:Hps5 APN 7 46762942 critical splice donor site probably null
IGL02056:Hps5 APN 7 46788182 missense probably damaging 1.00
IGL02117:Hps5 APN 7 46783516 missense probably damaging 1.00
IGL02210:Hps5 APN 7 46786570 missense probably benign 0.03
IGL02967:Hps5 APN 7 46769380 missense possibly damaging 0.69
IGL03046:Hps5 APN 7 46777039 splice site probably benign
IGL03187:Hps5 APN 7 46773207 missense probably damaging 1.00
IGL03259:Hps5 APN 7 46763102 missense probably damaging 0.99
dorian_gray UTSW 7 46784145 unclassified probably benign
smoky UTSW 7 46769351 nonsense probably null
Titan UTSW 7 46783469 critical splice donor site probably null
toffee UTSW 7 46777075 intron probably benign
wombat UTSW 7 46783634 missense probably damaging 1.00
R0068:Hps5 UTSW 7 46777042 splice site probably benign
R0068:Hps5 UTSW 7 46777042 splice site probably benign
R0141:Hps5 UTSW 7 46789181 missense probably damaging 1.00
R0383:Hps5 UTSW 7 46769288 splice site probably null
R0402:Hps5 UTSW 7 46790909 splice site probably benign
R0684:Hps5 UTSW 7 46783469 critical splice donor site probably null
R1159:Hps5 UTSW 7 46772554 unclassified probably null
R1938:Hps5 UTSW 7 46773267 missense probably damaging 1.00
R2058:Hps5 UTSW 7 46768051 missense probably damaging 1.00
R3613:Hps5 UTSW 7 46776874 critical splice donor site probably null
R3881:Hps5 UTSW 7 46771996 missense possibly damaging 0.54
R3882:Hps5 UTSW 7 46771996 missense possibly damaging 0.54
R3914:Hps5 UTSW 7 46783526 missense probably damaging 1.00
R4095:Hps5 UTSW 7 46775794 missense probably benign 0.01
R4457:Hps5 UTSW 7 46783613 missense probably benign 0.00
R4739:Hps5 UTSW 7 46786589 missense probably benign
R4838:Hps5 UTSW 7 46788354 missense probably damaging 1.00
R4934:Hps5 UTSW 7 46769351 nonsense probably null
R6056:Hps5 UTSW 7 46767097 missense probably benign 0.00
R6129:Hps5 UTSW 7 46771774 missense probably benign
R6878:Hps5 UTSW 7 46783634 missense probably damaging 1.00
R7912:Hps5 UTSW 7 46769402 missense probably benign 0.15
R7977:Hps5 UTSW 7 46769051 missense probably benign 0.03
R7987:Hps5 UTSW 7 46769051 missense probably benign 0.03
R8131:Hps5 UTSW 7 46771888 missense probably benign 0.00
R8243:Hps5 UTSW 7 46786642 missense probably damaging 1.00
R8245:Hps5 UTSW 7 46769061 nonsense probably null
X0021:Hps5 UTSW 7 46763093 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCCTTCCTAGAACATCAG -3'
(R):5'- TGTTACATTGTGTCCCGGGC -3'

Sequencing Primer
(F):5'- CTAGAACATCAGACAAGAATAGTTCG -3'
(R):5'- CCGGGCAGGGGAGAGAAG -3'
Posted On2017-02-10