Incidental Mutation 'R5876:Arnt2'
ID455530
Institutional Source Beutler Lab
Gene Symbol Arnt2
Ensembl Gene ENSMUSG00000015709
Gene Namearyl hydrocarbon receptor nuclear translocator 2
SynonymsbHLHe1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5876 (G1)
Quality Score194
Status Not validated
Chromosome7
Chromosomal Location84246278-84410176 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84347512 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 69 (T69A)
Ref Sequence ENSEMBL: ENSMUSP00000147129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085077] [ENSMUST00000207769] [ENSMUST00000208204] [ENSMUST00000208232] [ENSMUST00000208392] [ENSMUST00000208863] [ENSMUST00000208995] [ENSMUST00000209133]
Predicted Effect probably damaging
Transcript: ENSMUST00000085077
AA Change: T80A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082154
Gene: ENSMUSG00000015709
AA Change: T80A

DomainStartEndE-ValueType
HLH 69 122 1.42e-14 SMART
PAS 137 204 1.28e-8 SMART
low complexity region 225 236 N/A INTRINSIC
PAS 325 391 4.15e-8 SMART
PAC 398 441 7.93e-5 SMART
low complexity region 502 526 N/A INTRINSIC
low complexity region 597 626 N/A INTRINSIC
low complexity region 653 675 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207512
Predicted Effect probably damaging
Transcript: ENSMUST00000207769
AA Change: T76A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000208204
Predicted Effect probably damaging
Transcript: ENSMUST00000208232
AA Change: T69A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000208392
AA Change: T65A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000208863
AA Change: T69A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000208995
AA Change: T69A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000209133
AA Change: T69A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic-helix-loop-helix-Per-Arnt-Sim (bHLH-PAS) superfamily of transcription factors. The encoded protein acts as a partner for several sensor proteins of the bHLH-PAS family, forming heterodimers with the sensor proteins that bind regulatory DNA sequences in genes responsive to developmental and environmental stimuli. Under hypoxic conditions, the encoded protein complexes with hypoxia-inducible factor 1alpha in the nucleus and this complex binds to hypoxia-responsive elements in enhancers and promoters of oxygen-responsive genes. A highly similar protein in mouse forms functional complexes with both aryl hydrocarbon receptors and Single-minded proteins, suggesting additional roles for the encoded protein in the metabolism of xenobiotic compounds and the regulation of neurogenesis, respectively. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate this gene die shortly after birth, displaying impaired development of secretory neurons in the hypothalamus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,663,582 D64G possibly damaging Het
Ano2 T A 6: 126,039,279 M925K possibly damaging Het
Asap2 T A 12: 21,212,809 N229K possibly damaging Het
Atp13a3 T A 16: 30,362,734 N23Y probably benign Het
Cbr4 G A 8: 61,490,593 G91R possibly damaging Het
Cdc27 A T 11: 104,515,418 C624S probably benign Het
Cdc42bpg T A 19: 6,310,815 I201N probably damaging Het
Cdh5 A G 8: 104,142,577 Y645C probably damaging Het
Celsr2 C T 3: 108,413,943 V518I probably damaging Het
Clca4b T C 3: 144,912,060 T761A possibly damaging Het
Cpne4 C A 9: 104,925,770 S204R probably damaging Het
Dcaf1 T C 9: 106,863,650 W1279R probably damaging Het
Dennd4a C T 9: 64,911,755 P1731S probably damaging Het
Dmxl1 T A 18: 49,870,984 V892D possibly damaging Het
Fam131b A G 6: 42,321,248 probably null Het
Fam83b T A 9: 76,491,850 D657V possibly damaging Het
Fam83e T A 7: 45,722,363 probably null Het
Fbxo4 A T 15: 3,977,819 I121N probably damaging Het
Gabrg2 A G 11: 41,968,820 S202P probably damaging Het
Gm10471 T C 5: 26,084,718 E237G probably damaging Het
Grid2 T A 6: 64,663,162 I788N probably damaging Het
Grik4 T A 9: 42,688,023 N53Y probably damaging Het
Hipk2 A C 6: 38,730,867 probably null Het
Hps5 T C 7: 46,789,196 T38A probably damaging Het
Hs1bp3 A G 12: 8,341,843 D315G possibly damaging Het
Kdm4a C T 4: 118,138,876 M985I probably damaging Het
Kdm5d A G Y: 900,525 Y190C probably damaging Het
Krt86 T C 15: 101,476,610 S295P probably damaging Het
Matr3 T A 18: 35,587,738 D413E probably benign Het
Mbd5 T A 2: 49,274,645 F319L probably damaging Het
Mcoln1 T A 8: 3,510,910 Y411N probably damaging Het
Mpdz C A 4: 81,285,474 E1863* probably null Het
Mrps9 A G 1: 42,895,378 E173G probably damaging Het
Olfr8 A T 10: 78,955,357 I51F probably benign Het
Osmr T C 15: 6,821,047 T692A probably benign Het
Pkhd1l1 A T 15: 44,578,588 H3641L possibly damaging Het
Pml T C 9: 58,233,182 T421A possibly damaging Het
Podxl A G 6: 31,528,456 probably null Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prkag3 A G 1: 74,748,816 probably benign Het
Proz A G 8: 13,073,448 R240G probably benign Het
Ptpn13 C A 5: 103,476,960 D43E probably damaging Het
Rbm5 T G 9: 107,760,326 K135N probably damaging Het
Ska1 G A 18: 74,197,528 T201M probably damaging Het
Slc35f5 A C 1: 125,587,363 probably null Het
Slc9a3 T C 13: 74,161,723 L510P probably damaging Het
Svil A G 18: 5,082,828 K1231E probably damaging Het
Tanc2 T C 11: 105,922,613 S1628P possibly damaging Het
Tm9sf3 T A 19: 41,240,584 D260V probably damaging Het
Ttc9 G T 12: 81,631,622 R73L probably damaging Het
Vps13b A G 15: 35,917,061 I3684V probably damaging Het
Vps8 T C 16: 21,461,439 probably null Het
Vwa3b T A 1: 37,076,439 I328N probably damaging Het
Wdr1 C T 5: 38,530,023 V222M probably benign Het
Xpnpep1 T A 19: 52,997,008 T530S probably damaging Het
Zc3h6 C T 2: 128,993,277 S111F probably benign Het
Zfp768 G A 7: 127,344,546 P137S probably benign Het
Other mutations in Arnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Arnt2 APN 7 84285829 missense probably benign 0.01
IGL01525:Arnt2 APN 7 84275408 missense possibly damaging 0.70
IGL02331:Arnt2 APN 7 84265624 missense probably damaging 1.00
IGL02483:Arnt2 APN 7 84251397 missense probably damaging 1.00
IGL02863:Arnt2 APN 7 84267937 missense probably damaging 1.00
IGL03207:Arnt2 APN 7 84343834 missense possibly damaging 0.93
Arnold2 UTSW 7 84347530 missense probably damaging 1.00
porker UTSW 7 84343942 missense probably damaging 1.00
R0024:Arnt2 UTSW 7 84284126 missense probably benign 0.03
R0058:Arnt2 UTSW 7 84347530 missense probably damaging 1.00
R0058:Arnt2 UTSW 7 84347530 missense probably damaging 1.00
R0060:Arnt2 UTSW 7 84347530 missense probably damaging 1.00
R0113:Arnt2 UTSW 7 84347530 missense probably damaging 1.00
R0114:Arnt2 UTSW 7 84347530 missense probably damaging 1.00
R0201:Arnt2 UTSW 7 84361659 nonsense probably null
R0514:Arnt2 UTSW 7 84304859 missense probably benign 0.00
R0863:Arnt2 UTSW 7 84265584 missense probably damaging 1.00
R1800:Arnt2 UTSW 7 84275375 missense probably damaging 1.00
R1944:Arnt2 UTSW 7 84343751 missense probably benign 0.01
R1964:Arnt2 UTSW 7 84343789 missense possibly damaging 0.55
R2061:Arnt2 UTSW 7 84343870 missense probably damaging 1.00
R2216:Arnt2 UTSW 7 84275351 missense probably damaging 0.99
R3107:Arnt2 UTSW 7 84262444 missense possibly damaging 0.95
R3410:Arnt2 UTSW 7 84275447 missense probably damaging 1.00
R3739:Arnt2 UTSW 7 84343801 missense probably null 1.00
R4258:Arnt2 UTSW 7 84310955 missense probably damaging 0.98
R4486:Arnt2 UTSW 7 84275345 missense probably benign 0.03
R4489:Arnt2 UTSW 7 84275345 missense probably benign 0.03
R4668:Arnt2 UTSW 7 84275386 missense probably damaging 1.00
R5685:Arnt2 UTSW 7 84263265 missense probably benign 0.00
R5923:Arnt2 UTSW 7 84262533 missense probably benign 0.32
R5926:Arnt2 UTSW 7 84343946 missense probably damaging 0.99
R6122:Arnt2 UTSW 7 84361565 missense probably damaging 1.00
R7021:Arnt2 UTSW 7 84343942 missense probably damaging 1.00
R7895:Arnt2 UTSW 7 84305198 missense probably benign
R7978:Arnt2 UTSW 7 84305198 missense probably benign
R7981:Arnt2 UTSW 7 84268947 intron probably null
X0066:Arnt2 UTSW 7 84285784 missense possibly damaging 0.93
Z1176:Arnt2 UTSW 7 84263196 missense probably benign 0.41
Z1177:Arnt2 UTSW 7 84263207 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TACCTGCTCAGTGAGGAAGG -3'
(R):5'- CGAGTTACAGATGTGTCAGGG -3'

Sequencing Primer
(F):5'- CTCAGTGAGGAAGGAAGGCTTGTAG -3'
(R):5'- CACTGAGCCATTATGAGTTAGGTCC -3'
Posted On2017-02-10