Incidental Mutation 'R5876:Zfp768'
ID455531
Institutional Source Beutler Lab
Gene Symbol Zfp768
Ensembl Gene ENSMUSG00000047371
Gene Namezinc finger protein 768
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R5876 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location127342795-127345589 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127344546 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 137 (P137S)
Ref Sequence ENSEMBL: ENSMUSP00000145704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060783] [ENSMUST00000205266]
Predicted Effect probably benign
Transcript: ENSMUST00000060783
AA Change: P140S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000055374
Gene: ENSMUSG00000047371
AA Change: P140S

DomainStartEndE-ValueType
low complexity region 62 80 N/A INTRINSIC
Pfam:RNA_pol_Rpb1_R 112 130 3.7e-4 PFAM
Pfam:RNA_pol_Rpb1_R 133 152 1.3e-4 PFAM
low complexity region 271 288 N/A INTRINSIC
ZnF_C2H2 289 311 7.15e-2 SMART
ZnF_C2H2 317 339 1.22e-4 SMART
ZnF_C2H2 345 367 1.5e-4 SMART
ZnF_C2H2 373 395 4.3e-5 SMART
ZnF_C2H2 401 423 4.24e-4 SMART
ZnF_C2H2 429 451 9.58e-3 SMART
ZnF_C2H2 457 479 1.47e-3 SMART
ZnF_C2H2 485 507 7.49e-5 SMART
ZnF_C2H2 513 535 1.03e-2 SMART
ZnF_C2H2 541 563 6.52e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205266
AA Change: P137S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,663,582 D64G possibly damaging Het
Ano2 T A 6: 126,039,279 M925K possibly damaging Het
Arnt2 T C 7: 84,347,512 T69A probably damaging Het
Asap2 T A 12: 21,212,809 N229K possibly damaging Het
Atp13a3 T A 16: 30,362,734 N23Y probably benign Het
Cbr4 G A 8: 61,490,593 G91R possibly damaging Het
Cdc27 A T 11: 104,515,418 C624S probably benign Het
Cdc42bpg T A 19: 6,310,815 I201N probably damaging Het
Cdh5 A G 8: 104,142,577 Y645C probably damaging Het
Celsr2 C T 3: 108,413,943 V518I probably damaging Het
Clca4b T C 3: 144,912,060 T761A possibly damaging Het
Cpne4 C A 9: 104,925,770 S204R probably damaging Het
Dcaf1 T C 9: 106,863,650 W1279R probably damaging Het
Dennd4a C T 9: 64,911,755 P1731S probably damaging Het
Dmxl1 T A 18: 49,870,984 V892D possibly damaging Het
Fam131b A G 6: 42,321,248 probably null Het
Fam83b T A 9: 76,491,850 D657V possibly damaging Het
Fam83e T A 7: 45,722,363 probably null Het
Fbxo4 A T 15: 3,977,819 I121N probably damaging Het
Gabrg2 A G 11: 41,968,820 S202P probably damaging Het
Gm10471 T C 5: 26,084,718 E237G probably damaging Het
Grid2 T A 6: 64,663,162 I788N probably damaging Het
Grik4 T A 9: 42,688,023 N53Y probably damaging Het
Hipk2 A C 6: 38,730,867 probably null Het
Hps5 T C 7: 46,789,196 T38A probably damaging Het
Hs1bp3 A G 12: 8,341,843 D315G possibly damaging Het
Kdm4a C T 4: 118,138,876 M985I probably damaging Het
Kdm5d A G Y: 900,525 Y190C probably damaging Het
Krt86 T C 15: 101,476,610 S295P probably damaging Het
Matr3 T A 18: 35,587,738 D413E probably benign Het
Mbd5 T A 2: 49,274,645 F319L probably damaging Het
Mcoln1 T A 8: 3,510,910 Y411N probably damaging Het
Mpdz C A 4: 81,285,474 E1863* probably null Het
Mrps9 A G 1: 42,895,378 E173G probably damaging Het
Olfr8 A T 10: 78,955,357 I51F probably benign Het
Osmr T C 15: 6,821,047 T692A probably benign Het
Pkhd1l1 A T 15: 44,578,588 H3641L possibly damaging Het
Pml T C 9: 58,233,182 T421A possibly damaging Het
Podxl A G 6: 31,528,456 probably null Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prkag3 A G 1: 74,748,816 probably benign Het
Proz A G 8: 13,073,448 R240G probably benign Het
Ptpn13 C A 5: 103,476,960 D43E probably damaging Het
Rbm5 T G 9: 107,760,326 K135N probably damaging Het
Ska1 G A 18: 74,197,528 T201M probably damaging Het
Slc35f5 A C 1: 125,587,363 probably null Het
Slc9a3 T C 13: 74,161,723 L510P probably damaging Het
Svil A G 18: 5,082,828 K1231E probably damaging Het
Tanc2 T C 11: 105,922,613 S1628P possibly damaging Het
Tm9sf3 T A 19: 41,240,584 D260V probably damaging Het
Ttc9 G T 12: 81,631,622 R73L probably damaging Het
Vps13b A G 15: 35,917,061 I3684V probably damaging Het
Vps8 T C 16: 21,461,439 probably null Het
Vwa3b T A 1: 37,076,439 I328N probably damaging Het
Wdr1 C T 5: 38,530,023 V222M probably benign Het
Xpnpep1 T A 19: 52,997,008 T530S probably damaging Het
Zc3h6 C T 2: 128,993,277 S111F probably benign Het
Other mutations in Zfp768
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Zfp768 APN 7 127344531 missense possibly damaging 0.80
IGL03236:Zfp768 APN 7 127343970 missense possibly damaging 0.93
R1490:Zfp768 UTSW 7 127343631 missense probably damaging 1.00
R1497:Zfp768 UTSW 7 127343561 missense probably damaging 1.00
R2251:Zfp768 UTSW 7 127344378 missense probably benign
R2298:Zfp768 UTSW 7 127344189 missense probably benign 0.11
R2360:Zfp768 UTSW 7 127344638 missense probably benign 0.43
R4751:Zfp768 UTSW 7 127344762 missense possibly damaging 0.94
R4795:Zfp768 UTSW 7 127343375 missense possibly damaging 0.60
R5011:Zfp768 UTSW 7 127343703 missense probably damaging 1.00
R5518:Zfp768 UTSW 7 127344411 missense probably benign
R5602:Zfp768 UTSW 7 127344632 missense possibly damaging 0.73
R6245:Zfp768 UTSW 7 127344091 nonsense probably null
R6273:Zfp768 UTSW 7 127345147 critical splice donor site probably null
R6376:Zfp768 UTSW 7 127344720 missense probably benign 0.34
R6475:Zfp768 UTSW 7 127344655 missense probably damaging 0.97
R7125:Zfp768 UTSW 7 127344787 missense probably damaging 0.98
R7905:Zfp768 UTSW 7 127344659 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTTTCAAACTCAGGGCTATGGG -3'
(R):5'- CCCAAAGCCCAGAGTTTGAG -3'

Sequencing Primer
(F):5'- ACTCAGGGCTATGGGTTTTGAACTC -3'
(R):5'- TTTGAGCCACAAAGCCCAGAATTTG -3'
Posted On2017-02-10