Incidental Mutation 'R5876:Proz'
ID455533
Institutional Source Beutler Lab
Gene Symbol Proz
Ensembl Gene ENSMUSG00000031445
Gene Nameprotein Z, vitamin K-dependent plasma glycoprotein
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5876 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location13060914-13076026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13073448 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 240 (R240G)
Ref Sequence ENSEMBL: ENSMUSP00000033822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033822] [ENSMUST00000164416] [ENSMUST00000168164] [ENSMUST00000211363] [ENSMUST00000211453]
Predicted Effect probably benign
Transcript: ENSMUST00000033822
AA Change: R240G

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000033822
Gene: ENSMUSG00000031445
AA Change: R240G

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
GLA 22 86 7.03e-29 SMART
EGF 90 123 1.65e-6 SMART
EGF 128 166 1.19e-3 SMART
Tryp_SPc 182 394 6.49e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164416
SMART Domains Protein: ENSMUSP00000133204
Gene: ENSMUSG00000038542

DomainStartEndE-ValueType
PAM 144 312 4.29e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165885
Predicted Effect probably benign
Transcript: ENSMUST00000168164
Predicted Effect probably benign
Transcript: ENSMUST00000211363
Predicted Effect probably benign
Transcript: ENSMUST00000211453
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a liver vitamin K-dependent glycoprotein that is synthesized in the liver and secreted into the plasma. The encoded protein plays a role in regulating blood coagulation by complexing with protein Z-dependent protease inhibitor to directly inhibit activated factor X at the phospholipid surface. Deficiencies in this protein are associated with an increased risk of ischemic arterial diseases and fetal loss. Mutations in this gene are the cause of protein Z deficiency. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: When unchallenged, mice homozygous for a knock-out allele do not express an obvious phenotype; however, homozygotes exhibit significantly reduced survival following collagen/epinephrine-induced thromboembolism and develop enhanced thrombosis in the ferric chloride-induced arterial injury model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,663,582 D64G possibly damaging Het
Ano2 T A 6: 126,039,279 M925K possibly damaging Het
Arnt2 T C 7: 84,347,512 T69A probably damaging Het
Asap2 T A 12: 21,212,809 N229K possibly damaging Het
Atp13a3 T A 16: 30,362,734 N23Y probably benign Het
Cbr4 G A 8: 61,490,593 G91R possibly damaging Het
Cdc27 A T 11: 104,515,418 C624S probably benign Het
Cdc42bpg T A 19: 6,310,815 I201N probably damaging Het
Cdh5 A G 8: 104,142,577 Y645C probably damaging Het
Celsr2 C T 3: 108,413,943 V518I probably damaging Het
Clca4b T C 3: 144,912,060 T761A possibly damaging Het
Cpne4 C A 9: 104,925,770 S204R probably damaging Het
Dcaf1 T C 9: 106,863,650 W1279R probably damaging Het
Dennd4a C T 9: 64,911,755 P1731S probably damaging Het
Dmxl1 T A 18: 49,870,984 V892D possibly damaging Het
Fam131b A G 6: 42,321,248 probably null Het
Fam83b T A 9: 76,491,850 D657V possibly damaging Het
Fam83e T A 7: 45,722,363 probably null Het
Fbxo4 A T 15: 3,977,819 I121N probably damaging Het
Gabrg2 A G 11: 41,968,820 S202P probably damaging Het
Gm10471 T C 5: 26,084,718 E237G probably damaging Het
Grid2 T A 6: 64,663,162 I788N probably damaging Het
Grik4 T A 9: 42,688,023 N53Y probably damaging Het
Hipk2 A C 6: 38,730,867 probably null Het
Hps5 T C 7: 46,789,196 T38A probably damaging Het
Hs1bp3 A G 12: 8,341,843 D315G possibly damaging Het
Kdm4a C T 4: 118,138,876 M985I probably damaging Het
Kdm5d A G Y: 900,525 Y190C probably damaging Het
Krt86 T C 15: 101,476,610 S295P probably damaging Het
Matr3 T A 18: 35,587,738 D413E probably benign Het
Mbd5 T A 2: 49,274,645 F319L probably damaging Het
Mcoln1 T A 8: 3,510,910 Y411N probably damaging Het
Mpdz C A 4: 81,285,474 E1863* probably null Het
Mrps9 A G 1: 42,895,378 E173G probably damaging Het
Olfr8 A T 10: 78,955,357 I51F probably benign Het
Osmr T C 15: 6,821,047 T692A probably benign Het
Pkhd1l1 A T 15: 44,578,588 H3641L possibly damaging Het
Pml T C 9: 58,233,182 T421A possibly damaging Het
Podxl A G 6: 31,528,456 probably null Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prkag3 A G 1: 74,748,816 probably benign Het
Ptpn13 C A 5: 103,476,960 D43E probably damaging Het
Rbm5 T G 9: 107,760,326 K135N probably damaging Het
Ska1 G A 18: 74,197,528 T201M probably damaging Het
Slc35f5 A C 1: 125,587,363 probably null Het
Slc9a3 T C 13: 74,161,723 L510P probably damaging Het
Svil A G 18: 5,082,828 K1231E probably damaging Het
Tanc2 T C 11: 105,922,613 S1628P possibly damaging Het
Tm9sf3 T A 19: 41,240,584 D260V probably damaging Het
Ttc9 G T 12: 81,631,622 R73L probably damaging Het
Vps13b A G 15: 35,917,061 I3684V probably damaging Het
Vps8 T C 16: 21,461,439 probably null Het
Vwa3b T A 1: 37,076,439 I328N probably damaging Het
Wdr1 C T 5: 38,530,023 V222M probably benign Het
Xpnpep1 T A 19: 52,997,008 T530S probably damaging Het
Zc3h6 C T 2: 128,993,277 S111F probably benign Het
Zfp768 G A 7: 127,344,546 P137S probably benign Het
Other mutations in Proz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01677:Proz APN 8 13065238 splice site probably benign
IGL01977:Proz APN 8 13066913 missense probably damaging 1.00
IGL02553:Proz APN 8 13065260 missense probably benign 0.00
IGL02991:Proz UTSW 8 13073490 missense probably benign 0.00
R0241:Proz UTSW 8 13065356 missense probably benign 0.02
R0241:Proz UTSW 8 13065356 missense probably benign 0.02
R0482:Proz UTSW 8 13073460 nonsense probably null
R1614:Proz UTSW 8 13066904 missense probably damaging 1.00
R1906:Proz UTSW 8 13073686 unclassified probably null
R2230:Proz UTSW 8 13063356 missense probably damaging 0.99
R2232:Proz UTSW 8 13063356 missense probably damaging 0.99
R2444:Proz UTSW 8 13061027 start gained probably benign
R3029:Proz UTSW 8 13061042 missense probably benign
R3847:Proz UTSW 8 13073533 missense probably benign 0.00
R3850:Proz UTSW 8 13073533 missense probably benign 0.00
R4063:Proz UTSW 8 13064621 missense probably damaging 1.00
R5104:Proz UTSW 8 13066931 missense probably damaging 1.00
R5309:Proz UTSW 8 13061049 missense probably damaging 1.00
R5337:Proz UTSW 8 13066854 missense probably benign 0.01
R5447:Proz UTSW 8 13072578 missense probably benign 0.31
R6739:Proz UTSW 8 13073451 missense possibly damaging 0.86
R7559:Proz UTSW 8 13063455 missense probably benign 0.01
R7842:Proz UTSW 8 13063406 missense probably benign 0.19
R7867:Proz UTSW 8 13061027 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AACCTGTTCAGATGGGCCTG -3'
(R):5'- GTTCCAGGGATGAGGACATG -3'

Sequencing Primer
(F):5'- GCTGTCCTGTATTCCAGAATAAAC -3'
(R):5'- TGAGGACATGCTCTGCAAAGTC -3'
Posted On2017-02-10