Incidental Mutation 'R5876:Dennd4a'
ID 455539
Institutional Source Beutler Lab
Gene Symbol Dennd4a
Ensembl Gene ENSMUSG00000053641
Gene Name DENN domain containing 4A
Synonyms F730015K02Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.465) question?
Stock # R5876 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 64718622-64826949 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 64819037 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 1731 (P1731S)
Ref Sequence ENSEMBL: ENSMUSP00000037915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038890]
AlphaFold E9Q8V6
Predicted Effect probably damaging
Transcript: ENSMUST00000038890
AA Change: P1731S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037915
Gene: ENSMUSG00000053641
AA Change: P1731S

DomainStartEndE-ValueType
internal_repeat_1 45 93 3.26e-5 PROSPERO
uDENN 169 276 1.71e-28 SMART
DENN 309 493 2.4e-73 SMART
dDENN 559 633 4.15e-27 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1176 1191 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1402 1417 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217307
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN domain-containing protein that may function as a guanine nucleotide exchange factor that specifically activates ras-related protein Rab-10. This protein also contains a interferon stimulated response element-binding domain and may be involved in regulating the v-myc avian myelocytomatosis viral (MYC) oncogene. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 8. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,796,654 (GRCm39) D64G possibly damaging Het
Ano2 T A 6: 126,016,242 (GRCm39) M925K possibly damaging Het
Arnt2 T C 7: 83,996,720 (GRCm39) T69A probably damaging Het
Asap2 T A 12: 21,262,810 (GRCm39) N229K possibly damaging Het
Atp13a3 T A 16: 30,181,552 (GRCm39) N23Y probably benign Het
Cbr4 G A 8: 61,943,627 (GRCm39) G91R possibly damaging Het
Cdc27 A T 11: 104,406,244 (GRCm39) C624S probably benign Het
Cdc42bpg T A 19: 6,360,845 (GRCm39) I201N probably damaging Het
Cdh5 A G 8: 104,869,209 (GRCm39) Y645C probably damaging Het
Celsr2 C T 3: 108,321,259 (GRCm39) V518I probably damaging Het
Clca4b T C 3: 144,617,821 (GRCm39) T761A possibly damaging Het
Cpne4 C A 9: 104,802,969 (GRCm39) S204R probably damaging Het
Dcaf1 T C 9: 106,740,849 (GRCm39) W1279R probably damaging Het
Dmxl1 T A 18: 50,004,051 (GRCm39) V892D possibly damaging Het
Fam131b A G 6: 42,298,182 (GRCm39) probably null Het
Fam83b T A 9: 76,399,132 (GRCm39) D657V possibly damaging Het
Fam83e T A 7: 45,371,787 (GRCm39) probably null Het
Fbxo4 A T 15: 4,007,301 (GRCm39) I121N probably damaging Het
Gabrg2 A G 11: 41,859,647 (GRCm39) S202P probably damaging Het
Grid2 T A 6: 64,640,146 (GRCm39) I788N probably damaging Het
Grik4 T A 9: 42,599,319 (GRCm39) N53Y probably damaging Het
Hipk2 A C 6: 38,707,802 (GRCm39) probably null Het
Hps5 T C 7: 46,438,620 (GRCm39) T38A probably damaging Het
Hs1bp3 A G 12: 8,391,843 (GRCm39) D315G possibly damaging Het
Kdm4a C T 4: 117,996,073 (GRCm39) M985I probably damaging Het
Kdm5d A G Y: 900,525 (GRCm39) Y190C probably damaging Het
Krt86 T C 15: 101,374,491 (GRCm39) S295P probably damaging Het
Matr3 T A 18: 35,720,791 (GRCm39) D413E probably benign Het
Mbd5 T A 2: 49,164,657 (GRCm39) F319L probably damaging Het
Mcoln1 T A 8: 3,560,910 (GRCm39) Y411N probably damaging Het
Mpdz C A 4: 81,203,711 (GRCm39) E1863* probably null Het
Mrps9 A G 1: 42,934,538 (GRCm39) E173G probably damaging Het
Or7a42 A T 10: 78,791,191 (GRCm39) I51F probably benign Het
Osmr T C 15: 6,850,528 (GRCm39) T692A probably benign Het
Pkhd1l1 A T 15: 44,441,984 (GRCm39) H3641L possibly damaging Het
Pml T C 9: 58,140,465 (GRCm39) T421A possibly damaging Het
Podxl A G 6: 31,505,391 (GRCm39) probably null Het
Ppargc1b C G 18: 61,442,164 (GRCm39) D591H probably damaging Het
Prkag3 A G 1: 74,787,975 (GRCm39) probably benign Het
Proz A G 8: 13,123,448 (GRCm39) R240G probably benign Het
Ptpn13 C A 5: 103,624,826 (GRCm39) D43E probably damaging Het
Rbm5 T G 9: 107,637,525 (GRCm39) K135N probably damaging Het
Ska1 G A 18: 74,330,599 (GRCm39) T201M probably damaging Het
Slc35f5 A C 1: 125,515,100 (GRCm39) probably null Het
Slc9a3 T C 13: 74,309,842 (GRCm39) L510P probably damaging Het
Speer4a2 T C 5: 26,289,716 (GRCm39) E237G probably damaging Het
Svil A G 18: 5,082,828 (GRCm39) K1231E probably damaging Het
Tanc2 T C 11: 105,813,439 (GRCm39) S1628P possibly damaging Het
Tm9sf3 T A 19: 41,229,023 (GRCm39) D260V probably damaging Het
Ttc9 G T 12: 81,678,396 (GRCm39) R73L probably damaging Het
Vps13b A G 15: 35,917,207 (GRCm39) I3684V probably damaging Het
Vps8 T C 16: 21,280,189 (GRCm39) probably null Het
Vwa3b T A 1: 37,115,520 (GRCm39) I328N probably damaging Het
Wdr1 C T 5: 38,687,366 (GRCm39) V222M probably benign Het
Xpnpep1 T A 19: 52,985,439 (GRCm39) T530S probably damaging Het
Zc3h6 C T 2: 128,835,197 (GRCm39) S111F probably benign Het
Zfp768 G A 7: 126,943,718 (GRCm39) P137S probably benign Het
Other mutations in Dennd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dennd4a APN 9 64,819,044 (GRCm39) missense probably damaging 1.00
IGL01610:Dennd4a APN 9 64,814,166 (GRCm39) missense probably damaging 0.99
IGL01788:Dennd4a APN 9 64,749,903 (GRCm39) missense probably benign 0.00
IGL01827:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL01828:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL01829:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL01979:Dennd4a APN 9 64,801,691 (GRCm39) missense probably benign 0.00
IGL02100:Dennd4a APN 9 64,816,988 (GRCm39) splice site probably benign
IGL02339:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL02341:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL02584:Dennd4a APN 9 64,758,580 (GRCm39) missense probably damaging 1.00
IGL02607:Dennd4a APN 9 64,769,609 (GRCm39) missense probably damaging 0.99
IGL02654:Dennd4a APN 9 64,817,473 (GRCm39) splice site probably benign
IGL02701:Dennd4a APN 9 64,804,635 (GRCm39) missense possibly damaging 0.50
IGL03051:Dennd4a APN 9 64,769,696 (GRCm39) missense probably damaging 1.00
IGL03257:Dennd4a APN 9 64,779,156 (GRCm39) missense possibly damaging 0.93
IGL03346:Dennd4a APN 9 64,795,808 (GRCm39) missense possibly damaging 0.47
IGL03349:Dennd4a APN 9 64,796,256 (GRCm39) missense probably damaging 1.00
IGL03398:Dennd4a APN 9 64,779,164 (GRCm39) missense probably benign 0.32
R0010:Dennd4a UTSW 9 64,803,997 (GRCm39) missense probably benign 0.00
R0010:Dennd4a UTSW 9 64,803,997 (GRCm39) missense probably benign 0.00
R0129:Dennd4a UTSW 9 64,800,576 (GRCm39) missense probably damaging 1.00
R0220:Dennd4a UTSW 9 64,759,727 (GRCm39) missense probably damaging 1.00
R0396:Dennd4a UTSW 9 64,769,673 (GRCm39) missense probably damaging 1.00
R0881:Dennd4a UTSW 9 64,758,665 (GRCm39) critical splice donor site probably null
R1225:Dennd4a UTSW 9 64,818,957 (GRCm39) missense probably benign 0.03
R1311:Dennd4a UTSW 9 64,817,286 (GRCm39) missense probably benign 0.34
R1448:Dennd4a UTSW 9 64,813,327 (GRCm39) missense possibly damaging 0.95
R1450:Dennd4a UTSW 9 64,818,947 (GRCm39) missense probably benign 0.03
R1630:Dennd4a UTSW 9 64,779,164 (GRCm39) missense probably benign 0.32
R1709:Dennd4a UTSW 9 64,796,887 (GRCm39) missense possibly damaging 0.92
R1824:Dennd4a UTSW 9 64,766,640 (GRCm39) critical splice donor site probably null
R1851:Dennd4a UTSW 9 64,769,312 (GRCm39) missense probably damaging 1.00
R1870:Dennd4a UTSW 9 64,804,516 (GRCm39) missense probably benign 0.00
R1900:Dennd4a UTSW 9 64,804,618 (GRCm39) missense probably damaging 0.99
R1911:Dennd4a UTSW 9 64,796,368 (GRCm39) missense probably damaging 1.00
R1938:Dennd4a UTSW 9 64,749,772 (GRCm39) missense probably damaging 1.00
R1954:Dennd4a UTSW 9 64,759,749 (GRCm39) missense probably benign 0.02
R1955:Dennd4a UTSW 9 64,759,749 (GRCm39) missense probably benign 0.02
R2049:Dennd4a UTSW 9 64,796,887 (GRCm39) missense possibly damaging 0.92
R2129:Dennd4a UTSW 9 64,813,256 (GRCm39) splice site probably null
R2138:Dennd4a UTSW 9 64,796,619 (GRCm39) missense probably damaging 1.00
R2929:Dennd4a UTSW 9 64,759,699 (GRCm39) missense possibly damaging 0.85
R3083:Dennd4a UTSW 9 64,813,363 (GRCm39) missense probably benign 0.03
R3108:Dennd4a UTSW 9 64,819,669 (GRCm39) missense probably benign 0.23
R3176:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3177:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3276:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3277:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3890:Dennd4a UTSW 9 64,779,310 (GRCm39) missense probably damaging 1.00
R3953:Dennd4a UTSW 9 64,759,857 (GRCm39) missense probably damaging 1.00
R3963:Dennd4a UTSW 9 64,769,613 (GRCm39) missense probably damaging 1.00
R4059:Dennd4a UTSW 9 64,819,174 (GRCm39) missense possibly damaging 0.92
R4499:Dennd4a UTSW 9 64,817,405 (GRCm39) missense possibly damaging 0.78
R4500:Dennd4a UTSW 9 64,817,405 (GRCm39) missense possibly damaging 0.78
R4501:Dennd4a UTSW 9 64,817,405 (GRCm39) missense possibly damaging 0.78
R4671:Dennd4a UTSW 9 64,801,689 (GRCm39) missense probably benign
R4701:Dennd4a UTSW 9 64,804,639 (GRCm39) missense possibly damaging 0.91
R4821:Dennd4a UTSW 9 64,804,531 (GRCm39) missense possibly damaging 0.92
R4829:Dennd4a UTSW 9 64,796,338 (GRCm39) missense probably damaging 1.00
R4876:Dennd4a UTSW 9 64,803,872 (GRCm39) missense probably benign
R4881:Dennd4a UTSW 9 64,746,126 (GRCm39) missense possibly damaging 0.77
R4962:Dennd4a UTSW 9 64,813,285 (GRCm39) missense probably benign 0.00
R5225:Dennd4a UTSW 9 64,796,210 (GRCm39) missense possibly damaging 0.94
R5557:Dennd4a UTSW 9 64,811,509 (GRCm39) missense probably benign 0.07
R5649:Dennd4a UTSW 9 64,758,491 (GRCm39) splice site probably null
R5868:Dennd4a UTSW 9 64,804,011 (GRCm39) missense probably benign 0.02
R6052:Dennd4a UTSW 9 64,794,227 (GRCm39) missense probably damaging 1.00
R6411:Dennd4a UTSW 9 64,779,181 (GRCm39) missense probably benign 0.04
R6596:Dennd4a UTSW 9 64,759,702 (GRCm39) missense probably damaging 1.00
R6668:Dennd4a UTSW 9 64,794,247 (GRCm39) missense probably damaging 1.00
R6915:Dennd4a UTSW 9 64,759,771 (GRCm39) nonsense probably null
R7056:Dennd4a UTSW 9 64,814,205 (GRCm39) missense possibly damaging 0.89
R7107:Dennd4a UTSW 9 64,801,681 (GRCm39) missense possibly damaging 0.79
R7203:Dennd4a UTSW 9 64,803,756 (GRCm39) missense probably benign 0.05
R7238:Dennd4a UTSW 9 64,769,238 (GRCm39) missense probably damaging 1.00
R7373:Dennd4a UTSW 9 64,804,551 (GRCm39) missense probably benign 0.01
R7454:Dennd4a UTSW 9 64,759,852 (GRCm39) missense probably damaging 1.00
R7546:Dennd4a UTSW 9 64,780,326 (GRCm39) missense probably damaging 1.00
R7590:Dennd4a UTSW 9 64,795,869 (GRCm39) missense probably benign 0.01
R7662:Dennd4a UTSW 9 64,759,713 (GRCm39) missense probably damaging 1.00
R7782:Dennd4a UTSW 9 64,814,202 (GRCm39) missense probably damaging 0.98
R7909:Dennd4a UTSW 9 64,780,275 (GRCm39) critical splice acceptor site probably null
R7976:Dennd4a UTSW 9 64,759,794 (GRCm39) missense possibly damaging 0.95
R8026:Dennd4a UTSW 9 64,780,312 (GRCm39) missense probably damaging 1.00
R8034:Dennd4a UTSW 9 64,795,850 (GRCm39) missense probably benign 0.01
R8089:Dennd4a UTSW 9 64,756,457 (GRCm39) missense probably damaging 1.00
R8298:Dennd4a UTSW 9 64,814,157 (GRCm39) missense probably benign 0.00
R8397:Dennd4a UTSW 9 64,796,391 (GRCm39) missense probably benign
R8425:Dennd4a UTSW 9 64,746,256 (GRCm39) missense probably damaging 1.00
R8495:Dennd4a UTSW 9 64,794,161 (GRCm39) missense probably damaging 1.00
R8855:Dennd4a UTSW 9 64,819,672 (GRCm39) missense probably benign
R9219:Dennd4a UTSW 9 64,796,376 (GRCm39) missense probably damaging 0.96
R9275:Dennd4a UTSW 9 64,749,906 (GRCm39) missense probably damaging 1.00
R9376:Dennd4a UTSW 9 64,819,974 (GRCm39) missense probably benign 0.00
R9485:Dennd4a UTSW 9 64,814,388 (GRCm39) nonsense probably null
R9672:Dennd4a UTSW 9 64,800,640 (GRCm39) missense probably benign
R9746:Dennd4a UTSW 9 64,801,793 (GRCm39) missense probably benign
X0026:Dennd4a UTSW 9 64,804,602 (GRCm39) missense possibly damaging 0.67
Z1088:Dennd4a UTSW 9 64,779,304 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCAGTGGGTATCAAATGTGTAA -3'
(R):5'- GGCACCACTAGCAACCAGTT -3'

Sequencing Primer
(F):5'- TCCCTCAGTGATGGAGAGTCATC -3'
(R):5'- TAGCAACCAGTTAACACTCACTCTC -3'
Posted On 2017-02-10