Incidental Mutation 'R5876:Rbm5'
ID455542
Institutional Source Beutler Lab
Gene Symbol Rbm5
Ensembl Gene ENSMUSG00000032580
Gene NameRNA binding motif protein 5
SynonymsD030069N10Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R5876 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location107740371-107770996 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 107760326 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 135 (K135N)
Ref Sequence ENSEMBL: ENSMUSP00000138379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035199] [ENSMUST00000182022] [ENSMUST00000182304] [ENSMUST00000182371] [ENSMUST00000182421] [ENSMUST00000182659] [ENSMUST00000183248] [ENSMUST00000192130]
Predicted Effect probably damaging
Transcript: ENSMUST00000035199
AA Change: K135N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035199
Gene: ENSMUSG00000032580
AA Change: K135N

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
RRM 99 174 5.98e-13 SMART
ZnF_RBZ 183 207 1.53e-6 SMART
RRM 232 311 9.5e-7 SMART
low complexity region 329 355 N/A INTRINSIC
low complexity region 362 385 N/A INTRINSIC
low complexity region 393 410 N/A INTRINSIC
low complexity region 425 446 N/A INTRINSIC
Blast:RRM_2 483 506 1e-5 BLAST
low complexity region 520 536 N/A INTRINSIC
low complexity region 569 581 N/A INTRINSIC
low complexity region 627 641 N/A INTRINSIC
ZnF_C2H2 647 672 5.2e0 SMART
coiled coil region 673 707 N/A INTRINSIC
G_patch 741 787 1.85e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182007
Predicted Effect probably damaging
Transcript: ENSMUST00000182022
AA Change: K135N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138390
Gene: ENSMUSG00000032580
AA Change: K135N

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
SCOP:d1h6kx_ 96 137 2e-3 SMART
Blast:RRM 99 137 3e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182073
Predicted Effect possibly damaging
Transcript: ENSMUST00000182304
AA Change: K135N

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138380
Gene: ENSMUSG00000032580
AA Change: K135N

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
RRM 99 174 5.98e-13 SMART
ZnF_RBZ 183 207 1.53e-6 SMART
PDB:2LKZ|A 231 251 5e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000182371
AA Change: K135N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138119
Gene: ENSMUSG00000032580
AA Change: K135N

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
SCOP:d1h6kx_ 96 138 6e-3 SMART
Blast:RRM 99 136 3e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000182421
SMART Domains Protein: ENSMUSP00000138778
Gene: ENSMUSG00000032580

DomainStartEndE-ValueType
low complexity region 21 59 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182659
AA Change: K135N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138379
Gene: ENSMUSG00000032580
AA Change: K135N

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
RRM 99 174 5.98e-13 SMART
ZnF_RBZ 183 207 1.53e-6 SMART
RRM 232 311 9.5e-7 SMART
low complexity region 329 355 N/A INTRINSIC
low complexity region 362 385 N/A INTRINSIC
low complexity region 393 410 N/A INTRINSIC
low complexity region 425 446 N/A INTRINSIC
Blast:RRM_2 483 506 1e-5 BLAST
low complexity region 520 536 N/A INTRINSIC
low complexity region 569 581 N/A INTRINSIC
low complexity region 627 641 N/A INTRINSIC
ZnF_C2H2 647 672 5.2e0 SMART
coiled coil region 673 707 N/A INTRINSIC
G_patch 741 787 1.85e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183248
SMART Domains Protein: ENSMUSP00000138294
Gene: ENSMUSG00000032580

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183307
Predicted Effect probably damaging
Transcript: ENSMUST00000192130
AA Change: K135N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142194
Gene: ENSMUSG00000032580
AA Change: K135N

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
SCOP:d1h6kx_ 96 138 6e-3 SMART
Blast:RRM 99 136 3e-19 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000193342
AA Change: K92N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194801
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate tumor suppressor gene which encodes a nuclear RNA binding protein that is a component of the spliceosome A complex. The encoded protein plays a role in the induction of cell cycle arrest and apoptosis through pre-mRNA splicing of multiple target genes including the tumor suppressor protein p53. This gene is located within the tumor suppressor region 3p21.3, and may play a role in the inhibition of tumor transformation and progression of several malignancies including lung cancer. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility with azoospermia, male germ cell apoptosis, round spermatid arrest and spermatid differentiation arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,663,582 D64G possibly damaging Het
Ano2 T A 6: 126,039,279 M925K possibly damaging Het
Arnt2 T C 7: 84,347,512 T69A probably damaging Het
Asap2 T A 12: 21,212,809 N229K possibly damaging Het
Atp13a3 T A 16: 30,362,734 N23Y probably benign Het
Cbr4 G A 8: 61,490,593 G91R possibly damaging Het
Cdc27 A T 11: 104,515,418 C624S probably benign Het
Cdc42bpg T A 19: 6,310,815 I201N probably damaging Het
Cdh5 A G 8: 104,142,577 Y645C probably damaging Het
Celsr2 C T 3: 108,413,943 V518I probably damaging Het
Clca4b T C 3: 144,912,060 T761A possibly damaging Het
Cpne4 C A 9: 104,925,770 S204R probably damaging Het
Dcaf1 T C 9: 106,863,650 W1279R probably damaging Het
Dennd4a C T 9: 64,911,755 P1731S probably damaging Het
Dmxl1 T A 18: 49,870,984 V892D possibly damaging Het
Fam131b A G 6: 42,321,248 probably null Het
Fam83b T A 9: 76,491,850 D657V possibly damaging Het
Fam83e T A 7: 45,722,363 probably null Het
Fbxo4 A T 15: 3,977,819 I121N probably damaging Het
Gabrg2 A G 11: 41,968,820 S202P probably damaging Het
Gm10471 T C 5: 26,084,718 E237G probably damaging Het
Grid2 T A 6: 64,663,162 I788N probably damaging Het
Grik4 T A 9: 42,688,023 N53Y probably damaging Het
Hipk2 A C 6: 38,730,867 probably null Het
Hps5 T C 7: 46,789,196 T38A probably damaging Het
Hs1bp3 A G 12: 8,341,843 D315G possibly damaging Het
Kdm4a C T 4: 118,138,876 M985I probably damaging Het
Kdm5d A G Y: 900,525 Y190C probably damaging Het
Krt86 T C 15: 101,476,610 S295P probably damaging Het
Matr3 T A 18: 35,587,738 D413E probably benign Het
Mbd5 T A 2: 49,274,645 F319L probably damaging Het
Mcoln1 T A 8: 3,510,910 Y411N probably damaging Het
Mpdz C A 4: 81,285,474 E1863* probably null Het
Mrps9 A G 1: 42,895,378 E173G probably damaging Het
Olfr8 A T 10: 78,955,357 I51F probably benign Het
Osmr T C 15: 6,821,047 T692A probably benign Het
Pkhd1l1 A T 15: 44,578,588 H3641L possibly damaging Het
Pml T C 9: 58,233,182 T421A possibly damaging Het
Podxl A G 6: 31,528,456 probably null Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prkag3 A G 1: 74,748,816 probably benign Het
Proz A G 8: 13,073,448 R240G probably benign Het
Ptpn13 C A 5: 103,476,960 D43E probably damaging Het
Ska1 G A 18: 74,197,528 T201M probably damaging Het
Slc35f5 A C 1: 125,587,363 probably null Het
Slc9a3 T C 13: 74,161,723 L510P probably damaging Het
Svil A G 18: 5,082,828 K1231E probably damaging Het
Tanc2 T C 11: 105,922,613 S1628P possibly damaging Het
Tm9sf3 T A 19: 41,240,584 D260V probably damaging Het
Ttc9 G T 12: 81,631,622 R73L probably damaging Het
Vps13b A G 15: 35,917,061 I3684V probably damaging Het
Vps8 T C 16: 21,461,439 probably null Het
Vwa3b T A 1: 37,076,439 I328N probably damaging Het
Wdr1 C T 5: 38,530,023 V222M probably benign Het
Xpnpep1 T A 19: 52,997,008 T530S probably damaging Het
Zc3h6 C T 2: 128,993,277 S111F probably benign Het
Zfp768 G A 7: 127,344,546 P137S probably benign Het
Other mutations in Rbm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02041:Rbm5 APN 9 107755846 unclassified probably benign
IGL02319:Rbm5 APN 9 107743865 nonsense probably null
IGL02567:Rbm5 APN 9 107744274 missense probably damaging 1.00
IGL02868:Rbm5 APN 9 107749700 splice site probably benign
IGL02943:Rbm5 APN 9 107744343 missense probably damaging 1.00
IGL02959:Rbm5 APN 9 107754185 unclassified probably benign
IGL03029:Rbm5 APN 9 107754453 missense possibly damaging 0.46
PIT4403001:Rbm5 UTSW 9 107760336 missense probably damaging 1.00
R0001:Rbm5 UTSW 9 107742424 missense probably damaging 1.00
R0242:Rbm5 UTSW 9 107751708 splice site probably benign
R1170:Rbm5 UTSW 9 107742497 missense probably damaging 0.99
R1239:Rbm5 UTSW 9 107752966 unclassified probably benign
R1297:Rbm5 UTSW 9 107744242 missense probably damaging 1.00
R1719:Rbm5 UTSW 9 107743913 critical splice acceptor site probably null
R1764:Rbm5 UTSW 9 107767564 nonsense probably null
R1826:Rbm5 UTSW 9 107742414 missense probably damaging 0.98
R1863:Rbm5 UTSW 9 107750519 missense possibly damaging 0.70
R4112:Rbm5 UTSW 9 107765597 missense probably damaging 1.00
R4207:Rbm5 UTSW 9 107750483 missense probably benign
R4343:Rbm5 UTSW 9 107752196 missense probably damaging 1.00
R4441:Rbm5 UTSW 9 107749688 intron probably benign
R4621:Rbm5 UTSW 9 107754146 missense probably damaging 1.00
R4767:Rbm5 UTSW 9 107745213 missense probably damaging 1.00
R5090:Rbm5 UTSW 9 107760312 splice site probably benign
R5404:Rbm5 UTSW 9 107765553 missense probably damaging 1.00
R5959:Rbm5 UTSW 9 107752140 missense probably benign 0.02
R5983:Rbm5 UTSW 9 107744942 missense probably damaging 1.00
R5984:Rbm5 UTSW 9 107744942 missense probably damaging 1.00
R7436:Rbm5 UTSW 9 107750394 intron probably null
R7447:Rbm5 UTSW 9 107746179 missense probably damaging 1.00
R7867:Rbm5 UTSW 9 107751731 missense probably benign 0.02
R7950:Rbm5 UTSW 9 107751731 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCAACAGTCAAACAAGGAGTTC -3'
(R):5'- CCACGAGGTTAAGGGTTTAGTC -3'

Sequencing Primer
(F):5'- GGAGTTCATAAATCACTACTTACCG -3'
(R):5'- GTATAGCCCACTTTGTAGACCAGG -3'
Posted On2017-02-10