Mutagenetix > Incidental Mutation

Incidental Mutation 'R5876:Slc9a3'

455549

Institutional Source

Beutler Lab

Gene Symbol

Slc9a3

Ensembl Gene

ENSMUSG00000036123

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 3

Synonyms

9030624O13Rik, NHE-3, NHE3

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5876 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

74121457-74169442 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 74161723 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 510 (L510P)

Ref Sequence

ENSEMBL: ENSMUSP00000153255 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036208] [ENSMUST00000221703] [ENSMUST00000225423]

AlphaFold

G3X939

Predicted Effect

probably damaging
Transcript: ENSMUST00000036208
AA Change: L510P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000038142
Gene: ENSMUSG00000036123
AA Change: L510P

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Na_H_Exchanger	53	457	3.6e-87	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000221703
AA Change: L510P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000225423
AA Change: L510P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial brush border Na/H exchanger that uses an inward sodium ion gradient to expel acids from the cell. Defects in this gene are a cause of congenital secretory sodium diarrhea. Pseudogenes of this gene exist on chromosomes 10 and 22. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice have diarrhea associated with defects of renal and intestinal absorption. Males are infertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034E13Rik	A	G	18: 52,663,582	D64G	possibly damaging	Het
Ano2	T	A	6: 126,039,279	M925K	possibly damaging	Het
Arnt2	T	C	7: 84,347,512	T69A	probably damaging	Het
Asap2	T	A	12: 21,212,809	N229K	possibly damaging	Het
Atp13a3	T	A	16: 30,362,734	N23Y	probably benign	Het
Cbr4	G	A	8: 61,490,593	G91R	possibly damaging	Het
Cdc27	A	T	11: 104,515,418	C624S	probably benign	Het
Cdc42bpg	T	A	19: 6,310,815	I201N	probably damaging	Het
Cdh5	A	G	8: 104,142,577	Y645C	probably damaging	Het
Celsr2	C	T	3: 108,413,943	V518I	probably damaging	Het
Clca4b	T	C	3: 144,912,060	T761A	possibly damaging	Het
Cpne4	C	A	9: 104,925,770	S204R	probably damaging	Het
Dcaf1	T	C	9: 106,863,650	W1279R	probably damaging	Het
Dennd4a	C	T	9: 64,911,755	P1731S	probably damaging	Het
Dmxl1	T	A	18: 49,870,984	V892D	possibly damaging	Het
Fam131b	A	G	6: 42,321,248		probably null	Het
Fam83b	T	A	9: 76,491,850	D657V	possibly damaging	Het
Fam83e	T	A	7: 45,722,363		probably null	Het
Fbxo4	A	T	15: 3,977,819	I121N	probably damaging	Het
Gabrg2	A	G	11: 41,968,820	S202P	probably damaging	Het
Gm10471	T	C	5: 26,084,718	E237G	probably damaging	Het
Grid2	T	A	6: 64,663,162	I788N	probably damaging	Het
Grik4	T	A	9: 42,688,023	N53Y	probably damaging	Het
Hipk2	A	C	6: 38,730,867		probably null	Het
Hps5	T	C	7: 46,789,196	T38A	probably damaging	Het
Hs1bp3	A	G	12: 8,341,843	D315G	possibly damaging	Het
Kdm4a	C	T	4: 118,138,876	M985I	probably damaging	Het
Kdm5d	A	G	Y: 900,525	Y190C	probably damaging	Het
Krt86	T	C	15: 101,476,610	S295P	probably damaging	Het
Matr3	T	A	18: 35,587,738	D413E	probably benign	Het
Mbd5	T	A	2: 49,274,645	F319L	probably damaging	Het
Mcoln1	T	A	8: 3,510,910	Y411N	probably damaging	Het
Mpdz	C	A	4: 81,285,474	E1863*	probably null	Het
Mrps9	A	G	1: 42,895,378	E173G	probably damaging	Het
Olfr8	A	T	10: 78,955,357	I51F	probably benign	Het
Osmr	T	C	15: 6,821,047	T692A	probably benign	Het
Pkhd1l1	A	T	15: 44,578,588	H3641L	possibly damaging	Het
Pml	T	C	9: 58,233,182	T421A	possibly damaging	Het
Podxl	A	G	6: 31,528,456		probably null	Het
Ppargc1b	C	G	18: 61,309,093	D591H	probably damaging	Het
Prkag3	A	G	1: 74,748,816		probably benign	Het
Proz	A	G	8: 13,073,448	R240G	probably benign	Het
Ptpn13	C	A	5: 103,476,960	D43E	probably damaging	Het
Rbm5	T	G	9: 107,760,326	K135N	probably damaging	Het
Ska1	G	A	18: 74,197,528	T201M	probably damaging	Het
Slc35f5	A	C	1: 125,587,363		probably null	Het
Svil	A	G	18: 5,082,828	K1231E	probably damaging	Het
Tanc2	T	C	11: 105,922,613	S1628P	possibly damaging	Het
Tm9sf3	T	A	19: 41,240,584	D260V	probably damaging	Het
Ttc9	G	T	12: 81,631,622	R73L	probably damaging	Het
Vps13b	A	G	15: 35,917,061	I3684V	probably damaging	Het
Vps8	T	C	16: 21,461,439		probably null	Het
Vwa3b	T	A	1: 37,076,439	I328N	probably damaging	Het
Wdr1	C	T	5: 38,530,023	V222M	probably benign	Het
Xpnpep1	T	A	19: 52,997,008	T530S	probably damaging	Het
Zc3h6	C	T	2: 128,993,277	S111F	probably benign	Het
Zfp768	G	A	7: 127,344,546	P137S	probably benign	Het

Other mutations in Slc9a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00835:Slc9a3	APN	13	74160302	missense	probably benign	0.19
IGL01299:Slc9a3	APN	13	74160263	missense	probably benign	0.33
IGL01390:Slc9a3	APN	13	74150761	missense	probably benign	0.01
IGL01814:Slc9a3	APN	13	74165972	missense	probably damaging	0.96
IGL02020:Slc9a3	APN	13	74158848	missense	probably damaging	0.99
IGL02072:Slc9a3	APN	13	74165859	missense	probably benign	0.00
IGL02186:Slc9a3	APN	13	74163114	missense	possibly damaging	0.94
IGL02878:Slc9a3	APN	13	74165357	nonsense	probably null
IGL03056:Slc9a3	APN	13	74150819	missense	probably damaging	1.00
R0090:Slc9a3	UTSW	13	74158728	missense	probably damaging	0.99
R0280:Slc9a3	UTSW	13	74159424	missense	probably damaging	1.00
R0359:Slc9a3	UTSW	13	74157607	missense	probably damaging	1.00
R0388:Slc9a3	UTSW	13	74121536	missense	unknown
R0396:Slc9a3	UTSW	13	74157784	critical splice donor site	probably null
R0893:Slc9a3	UTSW	13	74159246	missense	probably damaging	1.00
R1169:Slc9a3	UTSW	13	74150743	missense	probably damaging	0.98
R1640:Slc9a3	UTSW	13	74158818	missense	probably damaging	1.00
R1769:Slc9a3	UTSW	13	74163071	missense	probably benign	0.00
R1850:Slc9a3	UTSW	13	74161770	missense	probably benign	0.34
R1937:Slc9a3	UTSW	13	74166056	splice site	probably null
R2048:Slc9a3	UTSW	13	74163741	missense	probably damaging	1.00
R2146:Slc9a3	UTSW	13	74121603	missense	probably benign	0.00
R2495:Slc9a3	UTSW	13	74158703	missense	probably damaging	0.99
R2883:Slc9a3	UTSW	13	74158760	missense	probably damaging	1.00
R2938:Slc9a3	UTSW	13	74121669	missense	possibly damaging	0.62
R4538:Slc9a3	UTSW	13	74161732	missense	possibly damaging	0.56
R4580:Slc9a3	UTSW	13	74158886	nonsense	probably null
R4581:Slc9a3	UTSW	13	74164165	missense	probably damaging	0.99
R4841:Slc9a3	UTSW	13	74165837	missense	probably damaging	1.00
R4928:Slc9a3	UTSW	13	74157719	missense	probably damaging	1.00
R4965:Slc9a3	UTSW	13	74164293	missense	possibly damaging	0.62
R5079:Slc9a3	UTSW	13	74164287	missense	probably damaging	0.97
R5329:Slc9a3	UTSW	13	74150960	missense	possibly damaging	0.94
R5663:Slc9a3	UTSW	13	74163712	missense	probably damaging	0.98
R5919:Slc9a3	UTSW	13	74158740	missense	probably damaging	0.98
R6060:Slc9a3	UTSW	13	74150885	missense	probably damaging	1.00
R6562:Slc9a3	UTSW	13	74155161	missense	probably damaging	1.00
R6645:Slc9a3	UTSW	13	74164172	missense	probably damaging	0.99
R7145:Slc9a3	UTSW	13	74150678	missense	probably damaging	0.99
R7422:Slc9a3	UTSW	13	74150885	missense	probably damaging	1.00
R7565:Slc9a3	UTSW	13	74157694	missense	probably damaging	1.00
R7679:Slc9a3	UTSW	13	74160276	missense	possibly damaging	0.88
R8032:Slc9a3	UTSW	13	74157644	missense	probably damaging	1.00
R8080:Slc9a3	UTSW	13	74166027	missense	probably benign	0.30
R8158:Slc9a3	UTSW	13	74155122	missense	probably damaging	1.00
R8159:Slc9a3	UTSW	13	74164288	missense	probably benign	0.01
R8837:Slc9a3	UTSW	13	74157704	missense	probably damaging	1.00
R8939:Slc9a3	UTSW	13	74163776	missense	possibly damaging	0.93
R9111:Slc9a3	UTSW	13	74150801	missense	probably damaging	1.00
R9741:Slc9a3	UTSW	13	74158875	missense	possibly damaging	0.95
Z1176:Slc9a3	UTSW	13	74165856	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGTGGCATGATGACCTTTCAC -3'
(R):5'- CTAGACCGCATCTGATGTTTTAC -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- TACTTTAGCCCTCAACTTCAGCAGAG -3'

Posted On

2017-02-10