Incidental Mutation 'R5876:Fbxo4'
ID455551
Institutional Source Beutler Lab
Gene Symbol Fbxo4
Ensembl Gene ENSMUSG00000022184
Gene NameF-box protein 4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R5876 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location3965445-3979573 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3977819 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 121 (I121N)
Ref Sequence ENSEMBL: ENSMUSP00000022791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022791] [ENSMUST00000046633]
Predicted Effect probably damaging
Transcript: ENSMUST00000022791
AA Change: I121N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022791
Gene: ENSMUSG00000022184
AA Change: I121N

DomainStartEndE-ValueType
FBOX 60 100 5.57e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000046633
SMART Domains Protein: ENSMUSP00000038476
Gene: ENSMUSG00000041935

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148817
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous or heterozygous for a knock-out allele exhibit increased tumor incidence of lymphoblastic lineage and premature death. Mice homozygous for a different knock-out allele are indistinguishable from wild-type mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,663,582 D64G possibly damaging Het
Ano2 T A 6: 126,039,279 M925K possibly damaging Het
Arnt2 T C 7: 84,347,512 T69A probably damaging Het
Asap2 T A 12: 21,212,809 N229K possibly damaging Het
Atp13a3 T A 16: 30,362,734 N23Y probably benign Het
Cbr4 G A 8: 61,490,593 G91R possibly damaging Het
Cdc27 A T 11: 104,515,418 C624S probably benign Het
Cdc42bpg T A 19: 6,310,815 I201N probably damaging Het
Cdh5 A G 8: 104,142,577 Y645C probably damaging Het
Celsr2 C T 3: 108,413,943 V518I probably damaging Het
Clca4b T C 3: 144,912,060 T761A possibly damaging Het
Cpne4 C A 9: 104,925,770 S204R probably damaging Het
Dcaf1 T C 9: 106,863,650 W1279R probably damaging Het
Dennd4a C T 9: 64,911,755 P1731S probably damaging Het
Dmxl1 T A 18: 49,870,984 V892D possibly damaging Het
Fam131b A G 6: 42,321,248 probably null Het
Fam83b T A 9: 76,491,850 D657V possibly damaging Het
Fam83e T A 7: 45,722,363 probably null Het
Gabrg2 A G 11: 41,968,820 S202P probably damaging Het
Gm10471 T C 5: 26,084,718 E237G probably damaging Het
Grid2 T A 6: 64,663,162 I788N probably damaging Het
Grik4 T A 9: 42,688,023 N53Y probably damaging Het
Hipk2 A C 6: 38,730,867 probably null Het
Hps5 T C 7: 46,789,196 T38A probably damaging Het
Hs1bp3 A G 12: 8,341,843 D315G possibly damaging Het
Kdm4a C T 4: 118,138,876 M985I probably damaging Het
Kdm5d A G Y: 900,525 Y190C probably damaging Het
Krt86 T C 15: 101,476,610 S295P probably damaging Het
Matr3 T A 18: 35,587,738 D413E probably benign Het
Mbd5 T A 2: 49,274,645 F319L probably damaging Het
Mcoln1 T A 8: 3,510,910 Y411N probably damaging Het
Mpdz C A 4: 81,285,474 E1863* probably null Het
Mrps9 A G 1: 42,895,378 E173G probably damaging Het
Olfr8 A T 10: 78,955,357 I51F probably benign Het
Osmr T C 15: 6,821,047 T692A probably benign Het
Pkhd1l1 A T 15: 44,578,588 H3641L possibly damaging Het
Pml T C 9: 58,233,182 T421A possibly damaging Het
Podxl A G 6: 31,528,456 probably null Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prkag3 A G 1: 74,748,816 probably benign Het
Proz A G 8: 13,073,448 R240G probably benign Het
Ptpn13 C A 5: 103,476,960 D43E probably damaging Het
Rbm5 T G 9: 107,760,326 K135N probably damaging Het
Ska1 G A 18: 74,197,528 T201M probably damaging Het
Slc35f5 A C 1: 125,587,363 probably null Het
Slc9a3 T C 13: 74,161,723 L510P probably damaging Het
Svil A G 18: 5,082,828 K1231E probably damaging Het
Tanc2 T C 11: 105,922,613 S1628P possibly damaging Het
Tm9sf3 T A 19: 41,240,584 D260V probably damaging Het
Ttc9 G T 12: 81,631,622 R73L probably damaging Het
Vps13b A G 15: 35,917,061 I3684V probably damaging Het
Vps8 T C 16: 21,461,439 probably null Het
Vwa3b T A 1: 37,076,439 I328N probably damaging Het
Wdr1 C T 5: 38,530,023 V222M probably benign Het
Xpnpep1 T A 19: 52,997,008 T530S probably damaging Het
Zc3h6 C T 2: 128,993,277 S111F probably benign Het
Zfp768 G A 7: 127,344,546 P137S probably benign Het
Other mutations in Fbxo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01747:Fbxo4 APN 15 3965755 nonsense probably null
IGL01879:Fbxo4 APN 15 3975954 missense probably damaging 0.99
IGL03070:Fbxo4 APN 15 3977862 missense possibly damaging 0.63
PIT1430001:Fbxo4 UTSW 15 3979300 missense probably benign 0.07
R1601:Fbxo4 UTSW 15 3968965 missense possibly damaging 0.77
R4556:Fbxo4 UTSW 15 3965705 makesense probably null
R4557:Fbxo4 UTSW 15 3965705 makesense probably null
R4783:Fbxo4 UTSW 15 3969041 missense probably benign 0.11
R4784:Fbxo4 UTSW 15 3969041 missense probably benign 0.11
R4785:Fbxo4 UTSW 15 3969041 missense probably benign 0.11
R4871:Fbxo4 UTSW 15 3975912 missense probably damaging 1.00
R5023:Fbxo4 UTSW 15 3977756 splice site probably null
R5435:Fbxo4 UTSW 15 3965792 missense possibly damaging 0.73
R6423:Fbxo4 UTSW 15 3965792 missense possibly damaging 0.73
R6481:Fbxo4 UTSW 15 3965734 missense probably damaging 1.00
R6656:Fbxo4 UTSW 15 3975823 missense probably damaging 0.99
R6999:Fbxo4 UTSW 15 3977955 missense probably damaging 1.00
R7505:Fbxo4 UTSW 15 3971421 missense probably benign 0.09
R7543:Fbxo4 UTSW 15 3977903 missense probably damaging 1.00
R8182:Fbxo4 UTSW 15 3968969 missense probably damaging 1.00
X0028:Fbxo4 UTSW 15 3971451 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAAGGGGCATTCAGACAAATC -3'
(R):5'- AAACAGTTGCCCCAGACAGATG -3'

Sequencing Primer
(F):5'- GGGGCATTCAGACAAATCCTATGC -3'
(R):5'- GTTGCCCCAGACAGATGACCTC -3'
Posted On2017-02-10