Incidental Mutation 'R5876:Osmr'
ID455552
Institutional Source Beutler Lab
Gene Symbol Osmr
Ensembl Gene ENSMUSG00000022146
Gene Nameoncostatin M receptor
SynonymsOSMRB
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5876 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location6813577-6874969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6821047 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 692 (T692A)
Ref Sequence ENSEMBL: ENSMUSP00000135204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022746] [ENSMUST00000176826]
Predicted Effect probably benign
Transcript: ENSMUST00000022746
AA Change: T693A

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000022746
Gene: ENSMUSG00000022146
AA Change: T693A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 26 35 N/A INTRINSIC
Blast:FN3 234 317 9e-38 BLAST
FN3 330 412 6.25e-3 SMART
FN3 427 512 2.75e0 SMART
FN3 523 607 7.02e1 SMART
FN3 619 720 3.17e-4 SMART
transmembrane domain 736 758 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176554
Predicted Effect probably benign
Transcript: ENSMUST00000176826
AA Change: T692A

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000135204
Gene: ENSMUSG00000022146
AA Change: T692A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 26 35 N/A INTRINSIC
Blast:FN3 234 317 9e-38 BLAST
FN3 330 412 6.25e-3 SMART
FN3 427 512 2.75e0 SMART
FN3 523 606 2.77e1 SMART
FN3 618 719 3.17e-4 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I cytokine receptor family. The encoded protein heterodimerizes with interleukin 6 signal transducer to form the type II oncostatin M receptor and with interleukin 31 receptor A to form the interleukin 31 receptor, and thus transduces oncostatin M and interleukin 31 induced signaling events. Mutations in this gene have been associated with familial primary localized cutaneous amyloidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit anemia, decreased hematocrit, and reduced erythroid progenitor, erythrocyte, platelet, and megakaryocyte cells. Homozygotes also show increased susceptibility to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,663,582 D64G possibly damaging Het
Ano2 T A 6: 126,039,279 M925K possibly damaging Het
Arnt2 T C 7: 84,347,512 T69A probably damaging Het
Asap2 T A 12: 21,212,809 N229K possibly damaging Het
Atp13a3 T A 16: 30,362,734 N23Y probably benign Het
Cbr4 G A 8: 61,490,593 G91R possibly damaging Het
Cdc27 A T 11: 104,515,418 C624S probably benign Het
Cdc42bpg T A 19: 6,310,815 I201N probably damaging Het
Cdh5 A G 8: 104,142,577 Y645C probably damaging Het
Celsr2 C T 3: 108,413,943 V518I probably damaging Het
Clca4b T C 3: 144,912,060 T761A possibly damaging Het
Cpne4 C A 9: 104,925,770 S204R probably damaging Het
Dcaf1 T C 9: 106,863,650 W1279R probably damaging Het
Dennd4a C T 9: 64,911,755 P1731S probably damaging Het
Dmxl1 T A 18: 49,870,984 V892D possibly damaging Het
Fam131b A G 6: 42,321,248 probably null Het
Fam83b T A 9: 76,491,850 D657V possibly damaging Het
Fam83e T A 7: 45,722,363 probably null Het
Fbxo4 A T 15: 3,977,819 I121N probably damaging Het
Gabrg2 A G 11: 41,968,820 S202P probably damaging Het
Gm10471 T C 5: 26,084,718 E237G probably damaging Het
Grid2 T A 6: 64,663,162 I788N probably damaging Het
Grik4 T A 9: 42,688,023 N53Y probably damaging Het
Hipk2 A C 6: 38,730,867 probably null Het
Hps5 T C 7: 46,789,196 T38A probably damaging Het
Hs1bp3 A G 12: 8,341,843 D315G possibly damaging Het
Kdm4a C T 4: 118,138,876 M985I probably damaging Het
Kdm5d A G Y: 900,525 Y190C probably damaging Het
Krt86 T C 15: 101,476,610 S295P probably damaging Het
Matr3 T A 18: 35,587,738 D413E probably benign Het
Mbd5 T A 2: 49,274,645 F319L probably damaging Het
Mcoln1 T A 8: 3,510,910 Y411N probably damaging Het
Mpdz C A 4: 81,285,474 E1863* probably null Het
Mrps9 A G 1: 42,895,378 E173G probably damaging Het
Olfr8 A T 10: 78,955,357 I51F probably benign Het
Pkhd1l1 A T 15: 44,578,588 H3641L possibly damaging Het
Pml T C 9: 58,233,182 T421A possibly damaging Het
Podxl A G 6: 31,528,456 probably null Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prkag3 A G 1: 74,748,816 probably benign Het
Proz A G 8: 13,073,448 R240G probably benign Het
Ptpn13 C A 5: 103,476,960 D43E probably damaging Het
Rbm5 T G 9: 107,760,326 K135N probably damaging Het
Ska1 G A 18: 74,197,528 T201M probably damaging Het
Slc35f5 A C 1: 125,587,363 probably null Het
Slc9a3 T C 13: 74,161,723 L510P probably damaging Het
Svil A G 18: 5,082,828 K1231E probably damaging Het
Tanc2 T C 11: 105,922,613 S1628P possibly damaging Het
Tm9sf3 T A 19: 41,240,584 D260V probably damaging Het
Ttc9 G T 12: 81,631,622 R73L probably damaging Het
Vps13b A G 15: 35,917,061 I3684V probably damaging Het
Vps8 T C 16: 21,461,439 probably null Het
Vwa3b T A 1: 37,076,439 I328N probably damaging Het
Wdr1 C T 5: 38,530,023 V222M probably benign Het
Xpnpep1 T A 19: 52,997,008 T530S probably damaging Het
Zc3h6 C T 2: 128,993,277 S111F probably benign Het
Zfp768 G A 7: 127,344,546 P137S probably benign Het
Other mutations in Osmr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Osmr APN 15 6844445 nonsense probably null
IGL00335:Osmr APN 15 6837023 missense probably benign 0.00
IGL00497:Osmr APN 15 6847066 missense probably benign 0.26
IGL00510:Osmr APN 15 6823631 nonsense probably null
IGL00811:Osmr APN 15 6815666 missense probably benign 0.28
IGL00959:Osmr APN 15 6824605 missense probably benign 0.12
IGL01115:Osmr APN 15 6847201 splice site probably benign
IGL01307:Osmr APN 15 6844427 missense probably damaging 1.00
IGL01330:Osmr APN 15 6842028 missense probably damaging 1.00
IGL01633:Osmr APN 15 6824604 missense probably damaging 1.00
IGL01780:Osmr APN 15 6828663 missense probably benign 0.00
IGL02164:Osmr APN 15 6842048 missense probably damaging 0.99
IGL02207:Osmr APN 15 6847147 missense probably benign 0.07
IGL02338:Osmr APN 15 6837729 nonsense probably null
IGL02350:Osmr APN 15 6828663 missense probably benign 0.00
IGL02357:Osmr APN 15 6828663 missense probably benign 0.00
IGL02545:Osmr APN 15 6823579 missense probably damaging 0.98
IGL02619:Osmr APN 15 6841994 missense probably damaging 1.00
IGL02685:Osmr APN 15 6815573 missense probably benign 0.00
IGL02959:Osmr APN 15 6815897 missense possibly damaging 0.93
IGL03303:Osmr APN 15 6842808 missense probably benign 0.03
FR4548:Osmr UTSW 15 6837703 small insertion probably benign
FR4737:Osmr UTSW 15 6837706 nonsense probably null
R0149:Osmr UTSW 15 6841951 critical splice donor site probably null
R0361:Osmr UTSW 15 6841951 critical splice donor site probably null
R0492:Osmr UTSW 15 6824518 missense probably damaging 1.00
R0538:Osmr UTSW 15 6841938 splice site probably benign
R0585:Osmr UTSW 15 6837793 missense probably benign
R0980:Osmr UTSW 15 6852440 missense probably benign 0.00
R1221:Osmr UTSW 15 6823561 nonsense probably null
R1922:Osmr UTSW 15 6844367 missense possibly damaging 0.67
R2067:Osmr UTSW 15 6815415 missense probably benign 0.00
R2136:Osmr UTSW 15 6852462 missense probably damaging 1.00
R2156:Osmr UTSW 15 6844410 missense probably benign 0.04
R3683:Osmr UTSW 15 6837053 missense possibly damaging 0.95
R3735:Osmr UTSW 15 6822080 missense probably damaging 1.00
R3736:Osmr UTSW 15 6822080 missense probably damaging 1.00
R4011:Osmr UTSW 15 6824533 missense probably benign 0.01
R4175:Osmr UTSW 15 6852546 missense probably damaging 1.00
R4555:Osmr UTSW 15 6815720 missense possibly damaging 0.73
R4581:Osmr UTSW 15 6842894 missense probably benign 0.00
R4751:Osmr UTSW 15 6842852 missense probably damaging 1.00
R4758:Osmr UTSW 15 6852555 missense probably benign 0.23
R4986:Osmr UTSW 15 6816580 critical splice donor site probably null
R4997:Osmr UTSW 15 6815639 missense probably benign 0.25
R5077:Osmr UTSW 15 6844393 nonsense probably null
R5093:Osmr UTSW 15 6821079 missense probably damaging 0.96
R5120:Osmr UTSW 15 6827275 missense probably benign 0.16
R5331:Osmr UTSW 15 6842881 missense probably damaging 1.00
R5812:Osmr UTSW 15 6837059 missense probably damaging 0.99
R5819:Osmr UTSW 15 6815787 missense probably benign 0.00
R5986:Osmr UTSW 15 6844453 missense probably benign 0.36
R6018:Osmr UTSW 15 6815795 missense probably damaging 1.00
R6164:Osmr UTSW 15 6860352 missense probably benign 0.00
R6217:Osmr UTSW 15 6823566 missense probably damaging 1.00
R6312:Osmr UTSW 15 6823638 missense probably damaging 1.00
R6349:Osmr UTSW 15 6821063 missense probably benign 0.00
R6898:Osmr UTSW 15 6815883 missense probably damaging 0.97
R7139:Osmr UTSW 15 6821088 missense possibly damaging 0.79
R7412:Osmr UTSW 15 6823567 missense probably damaging 1.00
R7527:Osmr UTSW 15 6827122 missense probably damaging 1.00
R7630:Osmr UTSW 15 6816971 missense possibly damaging 0.53
R7730:Osmr UTSW 15 6824482 missense probably damaging 1.00
R7990:Osmr UTSW 15 6852467 missense possibly damaging 0.87
R8094:Osmr UTSW 15 6815621 missense possibly damaging 0.64
R8187:Osmr UTSW 15 6821004 missense probably damaging 1.00
R8260:Osmr UTSW 15 6815416 missense probably benign 0.41
R8366:Osmr UTSW 15 6820954 missense possibly damaging 0.82
RF040:Osmr UTSW 15 6837701 small insertion probably benign
RF055:Osmr UTSW 15 6837700 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCATCTGGAGAAAGCATAGGAAGTC -3'
(R):5'- AAAAGGTCTCTGCCACGTTCC -3'

Sequencing Primer
(F):5'- AGCATAGGAAGTCAACCGTG -3'
(R):5'- GATGACCTTGAGCACATTGC -3'
Posted On2017-02-10