Incidental Mutation 'R5876:Krt86'
ID455556
Institutional Source Beutler Lab
Gene Symbol Krt86
Ensembl Gene ENSMUSG00000067614
Gene Namekeratin 86
SynonymsKrt2-10, Khb4, Krt2-11, MHb4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R5876 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location101473478-101479986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101476610 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 295 (S295P)
Ref Sequence ENSEMBL: ENSMUSP00000085365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088049]
Predicted Effect probably damaging
Transcript: ENSMUST00000088049
AA Change: S295P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000085365
Gene: ENSMUSG00000067614
AA Change: S295P

DomainStartEndE-ValueType
Pfam:Keratin_2_head 2 102 4.6e-15 PFAM
Filament 105 416 6.92e-148 SMART
low complexity region 420 438 N/A INTRINSIC
low complexity region 469 486 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230173
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II keratin protein, which heterodimerizes with type I keratins to form hair and nails. This gene is present in a cluster of related genes and pseudogenes on chromosome 12. Mutations in this gene have been observed in patients with the hair disease monilethrix. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,663,582 D64G possibly damaging Het
Ano2 T A 6: 126,039,279 M925K possibly damaging Het
Arnt2 T C 7: 84,347,512 T69A probably damaging Het
Asap2 T A 12: 21,212,809 N229K possibly damaging Het
Atp13a3 T A 16: 30,362,734 N23Y probably benign Het
Cbr4 G A 8: 61,490,593 G91R possibly damaging Het
Cdc27 A T 11: 104,515,418 C624S probably benign Het
Cdc42bpg T A 19: 6,310,815 I201N probably damaging Het
Cdh5 A G 8: 104,142,577 Y645C probably damaging Het
Celsr2 C T 3: 108,413,943 V518I probably damaging Het
Clca4b T C 3: 144,912,060 T761A possibly damaging Het
Cpne4 C A 9: 104,925,770 S204R probably damaging Het
Dcaf1 T C 9: 106,863,650 W1279R probably damaging Het
Dennd4a C T 9: 64,911,755 P1731S probably damaging Het
Dmxl1 T A 18: 49,870,984 V892D possibly damaging Het
Fam131b A G 6: 42,321,248 probably null Het
Fam83b T A 9: 76,491,850 D657V possibly damaging Het
Fam83e T A 7: 45,722,363 probably null Het
Fbxo4 A T 15: 3,977,819 I121N probably damaging Het
Gabrg2 A G 11: 41,968,820 S202P probably damaging Het
Gm10471 T C 5: 26,084,718 E237G probably damaging Het
Grid2 T A 6: 64,663,162 I788N probably damaging Het
Grik4 T A 9: 42,688,023 N53Y probably damaging Het
Hipk2 A C 6: 38,730,867 probably null Het
Hps5 T C 7: 46,789,196 T38A probably damaging Het
Hs1bp3 A G 12: 8,341,843 D315G possibly damaging Het
Kdm4a C T 4: 118,138,876 M985I probably damaging Het
Kdm5d A G Y: 900,525 Y190C probably damaging Het
Matr3 T A 18: 35,587,738 D413E probably benign Het
Mbd5 T A 2: 49,274,645 F319L probably damaging Het
Mcoln1 T A 8: 3,510,910 Y411N probably damaging Het
Mpdz C A 4: 81,285,474 E1863* probably null Het
Mrps9 A G 1: 42,895,378 E173G probably damaging Het
Olfr8 A T 10: 78,955,357 I51F probably benign Het
Osmr T C 15: 6,821,047 T692A probably benign Het
Pkhd1l1 A T 15: 44,578,588 H3641L possibly damaging Het
Pml T C 9: 58,233,182 T421A possibly damaging Het
Podxl A G 6: 31,528,456 probably null Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prkag3 A G 1: 74,748,816 probably benign Het
Proz A G 8: 13,073,448 R240G probably benign Het
Ptpn13 C A 5: 103,476,960 D43E probably damaging Het
Rbm5 T G 9: 107,760,326 K135N probably damaging Het
Ska1 G A 18: 74,197,528 T201M probably damaging Het
Slc35f5 A C 1: 125,587,363 probably null Het
Slc9a3 T C 13: 74,161,723 L510P probably damaging Het
Svil A G 18: 5,082,828 K1231E probably damaging Het
Tanc2 T C 11: 105,922,613 S1628P possibly damaging Het
Tm9sf3 T A 19: 41,240,584 D260V probably damaging Het
Ttc9 G T 12: 81,631,622 R73L probably damaging Het
Vps13b A G 15: 35,917,061 I3684V probably damaging Het
Vps8 T C 16: 21,461,439 probably null Het
Vwa3b T A 1: 37,076,439 I328N probably damaging Het
Wdr1 C T 5: 38,530,023 V222M probably benign Het
Xpnpep1 T A 19: 52,997,008 T530S probably damaging Het
Zc3h6 C T 2: 128,993,277 S111F probably benign Het
Zfp768 G A 7: 127,344,546 P137S probably benign Het
Other mutations in Krt86
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Krt86 APN 15 101476515 missense possibly damaging 0.55
IGL00597:Krt86 APN 15 101476226 missense probably benign 0.01
IGL00776:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00800:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00801:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00857:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00902:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00903:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00939:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00954:Krt86 APN 15 101473860 missense probably benign 0.00
IGL01107:Krt86 APN 15 101475425 missense probably damaging 1.00
IGL01638:Krt86 APN 15 101475472 splice site probably benign
IGL02711:Krt86 APN 15 101473662 missense probably damaging 1.00
BB009:Krt86 UTSW 15 101476592 missense probably damaging 1.00
BB019:Krt86 UTSW 15 101476592 missense probably damaging 1.00
R0046:Krt86 UTSW 15 101477402 missense probably benign 0.00
R0193:Krt86 UTSW 15 101479363 splice site probably benign
R0242:Krt86 UTSW 15 101476573 nonsense probably null
R0242:Krt86 UTSW 15 101476573 nonsense probably null
R0607:Krt86 UTSW 15 101479531 missense unknown
R2139:Krt86 UTSW 15 101473758 missense probably benign 0.11
R4464:Krt86 UTSW 15 101473914 missense probably damaging 0.99
R4985:Krt86 UTSW 15 101477265 missense probably damaging 0.99
R5195:Krt86 UTSW 15 101476933 missense probably benign 0.10
R5587:Krt86 UTSW 15 101473593 missense probably benign 0.01
R5600:Krt86 UTSW 15 101476505 missense probably benign 0.00
R5729:Krt86 UTSW 15 101476548 missense probably benign 0.18
R6169:Krt86 UTSW 15 101476289 missense probably damaging 1.00
R6776:Krt86 UTSW 15 101476936 missense probably benign 0.29
R6990:Krt86 UTSW 15 101473833 missense probably benign 0.03
R7111:Krt86 UTSW 15 101476617 missense possibly damaging 0.90
R7932:Krt86 UTSW 15 101476592 missense probably damaging 1.00
Z1177:Krt86 UTSW 15 101476897 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGTCTTGTGTGGACCAGGG -3'
(R):5'- AAGATGCACAGTGGTCAGGC -3'

Sequencing Primer
(F):5'- GGCTGAGCCTTCAAGAAGTTTTTATC -3'
(R):5'- ACAGTGGTCAGGCTGGGC -3'
Posted On2017-02-10