Incidental Mutation 'R5876:Svil'
ID455559
Institutional Source Beutler Lab
Gene Symbol Svil
Ensembl Gene ENSMUSG00000024236
Gene Namesupervillin
SynonymsB430302E16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R5876 (G1)
Quality Score158
Status Not validated
Chromosome18
Chromosomal Location4920540-5119299 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5082828 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1231 (K1231E)
Ref Sequence ENSEMBL: ENSMUSP00000147843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025079] [ENSMUST00000126977] [ENSMUST00000127297] [ENSMUST00000131609] [ENSMUST00000140448] [ENSMUST00000143254] [ENSMUST00000210707]
Predicted Effect probably damaging
Transcript: ENSMUST00000025079
AA Change: K1144E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025079
Gene: ENSMUSG00000024236
AA Change: K1144E

DomainStartEndE-ValueType
low complexity region 1181 1191 N/A INTRINSIC
GEL 1397 1496 4.58e-22 SMART
GEL 1521 1638 4.03e-1 SMART
GEL 1708 1818 2.93e-20 SMART
low complexity region 1825 1831 N/A INTRINSIC
GEL 1837 1938 1.72e-17 SMART
GEL 1971 2078 1.37e0 SMART
VHP 2135 2170 1.15e-18 SMART
Predicted Effect unknown
Transcript: ENSMUST00000125512
AA Change: K130E
SMART Domains Protein: ENSMUSP00000121972
Gene: ENSMUSG00000024236
AA Change: K130E

DomainStartEndE-ValueType
low complexity region 168 178 N/A INTRINSIC
GEL 384 483 4.58e-22 SMART
GEL 508 625 4.03e-1 SMART
Blast:GEL 695 733 1e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000126977
AA Change: K1144E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115078
Gene: ENSMUSG00000024236
AA Change: K1144E

DomainStartEndE-ValueType
low complexity region 1181 1191 N/A INTRINSIC
GEL 1397 1496 4.58e-22 SMART
GEL 1521 1638 4.03e-1 SMART
GEL 1708 1818 2.93e-20 SMART
low complexity region 1825 1831 N/A INTRINSIC
GEL 1837 1938 1.72e-17 SMART
GEL 1971 2078 1.37e0 SMART
VHP 2135 2170 1.15e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127297
AA Change: K1030E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115223
Gene: ENSMUSG00000024236
AA Change: K1030E

DomainStartEndE-ValueType
low complexity region 1067 1077 N/A INTRINSIC
GEL 1283 1382 4.58e-22 SMART
GEL 1407 1524 4.03e-1 SMART
GEL 1594 1704 2.93e-20 SMART
low complexity region 1711 1717 N/A INTRINSIC
GEL 1723 1824 1.72e-17 SMART
GEL 1857 1964 1.37e0 SMART
VHP 2021 2056 1.15e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131609
AA Change: K1144E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122242
Gene: ENSMUSG00000024236
AA Change: K1144E

DomainStartEndE-ValueType
low complexity region 1181 1191 N/A INTRINSIC
GEL 1397 1496 2.9e-24 SMART
GEL 1521 1638 2.5e-3 SMART
GEL 1708 1818 1.9e-22 SMART
low complexity region 1825 1831 N/A INTRINSIC
GEL 1837 1938 1.1e-19 SMART
low complexity region 1965 1974 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000140448
AA Change: K1144E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119803
Gene: ENSMUSG00000024236
AA Change: K1144E

DomainStartEndE-ValueType
low complexity region 1181 1191 N/A INTRINSIC
GEL 1397 1496 4.58e-22 SMART
GEL 1521 1638 4.03e-1 SMART
GEL 1708 1818 2.93e-20 SMART
low complexity region 1825 1831 N/A INTRINSIC
GEL 1837 1938 1.72e-17 SMART
GEL 1971 2078 1.37e0 SMART
VHP 2135 2170 1.15e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143254
AA Change: K740E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119287
Gene: ENSMUSG00000024236
AA Change: K740E

DomainStartEndE-ValueType
low complexity region 777 787 N/A INTRINSIC
GEL 993 1092 4.58e-22 SMART
GEL 1117 1234 4.03e-1 SMART
GEL 1304 1414 2.93e-20 SMART
low complexity region 1421 1427 N/A INTRINSIC
GEL 1433 1534 1.72e-17 SMART
GEL 1567 1674 1.37e0 SMART
VHP 1731 1766 1.15e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000210707
AA Change: K1231E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bipartite protein with distinct amino- and carboxy-terminal domains. The amino-terminus contains nuclear localization signals and the carboxy-terminus contains numerous consecutive sequences with extensive similarity to proteins in the gelsolin family of actin-binding proteins, which cap, nucleate, and/or sever actin filaments. The gene product is tightly associated with both actin filaments and plasma membranes, suggesting a role as a high-affinity link between the actin cytoskeleton and the membrane. The encoded protein appears to aid in both myosin II assembly during cell spreading and disassembly of focal adhesions. Several transcript variants encoding different isoforms of supervillin have been described. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanched adhesion and thrombus formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,663,582 D64G possibly damaging Het
Ano2 T A 6: 126,039,279 M925K possibly damaging Het
Arnt2 T C 7: 84,347,512 T69A probably damaging Het
Asap2 T A 12: 21,212,809 N229K possibly damaging Het
Atp13a3 T A 16: 30,362,734 N23Y probably benign Het
Cbr4 G A 8: 61,490,593 G91R possibly damaging Het
Cdc27 A T 11: 104,515,418 C624S probably benign Het
Cdc42bpg T A 19: 6,310,815 I201N probably damaging Het
Cdh5 A G 8: 104,142,577 Y645C probably damaging Het
Celsr2 C T 3: 108,413,943 V518I probably damaging Het
Clca4b T C 3: 144,912,060 T761A possibly damaging Het
Cpne4 C A 9: 104,925,770 S204R probably damaging Het
Dcaf1 T C 9: 106,863,650 W1279R probably damaging Het
Dennd4a C T 9: 64,911,755 P1731S probably damaging Het
Dmxl1 T A 18: 49,870,984 V892D possibly damaging Het
Fam131b A G 6: 42,321,248 probably null Het
Fam83b T A 9: 76,491,850 D657V possibly damaging Het
Fam83e T A 7: 45,722,363 probably null Het
Fbxo4 A T 15: 3,977,819 I121N probably damaging Het
Gabrg2 A G 11: 41,968,820 S202P probably damaging Het
Gm10471 T C 5: 26,084,718 E237G probably damaging Het
Grid2 T A 6: 64,663,162 I788N probably damaging Het
Grik4 T A 9: 42,688,023 N53Y probably damaging Het
Hipk2 A C 6: 38,730,867 probably null Het
Hps5 T C 7: 46,789,196 T38A probably damaging Het
Hs1bp3 A G 12: 8,341,843 D315G possibly damaging Het
Kdm4a C T 4: 118,138,876 M985I probably damaging Het
Kdm5d A G Y: 900,525 Y190C probably damaging Het
Krt86 T C 15: 101,476,610 S295P probably damaging Het
Matr3 T A 18: 35,587,738 D413E probably benign Het
Mbd5 T A 2: 49,274,645 F319L probably damaging Het
Mcoln1 T A 8: 3,510,910 Y411N probably damaging Het
Mpdz C A 4: 81,285,474 E1863* probably null Het
Mrps9 A G 1: 42,895,378 E173G probably damaging Het
Olfr8 A T 10: 78,955,357 I51F probably benign Het
Osmr T C 15: 6,821,047 T692A probably benign Het
Pkhd1l1 A T 15: 44,578,588 H3641L possibly damaging Het
Pml T C 9: 58,233,182 T421A possibly damaging Het
Podxl A G 6: 31,528,456 probably null Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prkag3 A G 1: 74,748,816 probably benign Het
Proz A G 8: 13,073,448 R240G probably benign Het
Ptpn13 C A 5: 103,476,960 D43E probably damaging Het
Rbm5 T G 9: 107,760,326 K135N probably damaging Het
Ska1 G A 18: 74,197,528 T201M probably damaging Het
Slc35f5 A C 1: 125,587,363 probably null Het
Slc9a3 T C 13: 74,161,723 L510P probably damaging Het
Tanc2 T C 11: 105,922,613 S1628P possibly damaging Het
Tm9sf3 T A 19: 41,240,584 D260V probably damaging Het
Ttc9 G T 12: 81,631,622 R73L probably damaging Het
Vps13b A G 15: 35,917,061 I3684V probably damaging Het
Vps8 T C 16: 21,461,439 probably null Het
Vwa3b T A 1: 37,076,439 I328N probably damaging Het
Wdr1 C T 5: 38,530,023 V222M probably benign Het
Xpnpep1 T A 19: 52,997,008 T530S probably damaging Het
Zc3h6 C T 2: 128,993,277 S111F probably benign Het
Zfp768 G A 7: 127,344,546 P137S probably benign Het
Other mutations in Svil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Svil APN 18 5099045 missense probably benign 0.27
IGL00840:Svil APN 18 5063555 missense probably benign
IGL01329:Svil APN 18 5064501 missense probably benign
IGL01446:Svil APN 18 5062385 missense probably damaging 1.00
IGL02068:Svil APN 18 5092899 missense probably damaging 1.00
IGL02223:Svil APN 18 5105879 splice site probably benign
IGL02428:Svil APN 18 5118203 missense probably damaging 1.00
IGL02429:Svil APN 18 5118369 missense probably benign 0.00
IGL02479:Svil APN 18 5099476 missense probably damaging 1.00
IGL02560:Svil APN 18 5049379 missense probably benign 0.00
IGL02652:Svil APN 18 5114531 missense probably damaging 1.00
IGL03291:Svil APN 18 5056150 nonsense probably null
BB002:Svil UTSW 18 5118357 missense probably benign 0.00
BB012:Svil UTSW 18 5118357 missense probably benign 0.00
IGL03055:Svil UTSW 18 5108615 missense probably damaging 1.00
R0029:Svil UTSW 18 5063286 missense probably benign 0.14
R0029:Svil UTSW 18 5063286 missense probably benign 0.14
R0266:Svil UTSW 18 5099063 splice site probably benign
R0281:Svil UTSW 18 5094582 missense probably damaging 1.00
R0442:Svil UTSW 18 5046870 missense probably damaging 1.00
R0549:Svil UTSW 18 5064566 missense possibly damaging 0.79
R0617:Svil UTSW 18 5117002 missense probably damaging 1.00
R0801:Svil UTSW 18 5099443 missense probably benign 0.00
R0894:Svil UTSW 18 5097494 missense probably damaging 1.00
R1053:Svil UTSW 18 5056690 missense probably benign 0.16
R1065:Svil UTSW 18 5063777 splice site probably benign
R1080:Svil UTSW 18 5058147 missense possibly damaging 0.79
R1199:Svil UTSW 18 5059217 splice site probably benign
R1472:Svil UTSW 18 5048950 missense probably benign 0.09
R1480:Svil UTSW 18 5057345 missense probably damaging 1.00
R1544:Svil UTSW 18 5046817 missense possibly damaging 0.93
R1626:Svil UTSW 18 5117099 critical splice donor site probably null
R1691:Svil UTSW 18 5056336 missense probably benign 0.06
R1812:Svil UTSW 18 5097545 missense probably damaging 1.00
R1826:Svil UTSW 18 5063383 missense probably benign 0.01
R1842:Svil UTSW 18 5062373 missense probably damaging 1.00
R1884:Svil UTSW 18 5094640 missense possibly damaging 0.94
R1945:Svil UTSW 18 5117059 missense probably damaging 1.00
R2184:Svil UTSW 18 5099534 missense probably damaging 1.00
R2184:Svil UTSW 18 5099615 missense probably damaging 1.00
R2232:Svil UTSW 18 5046640 start codon destroyed probably null 0.98
R2398:Svil UTSW 18 5060613 splice site probably null
R3076:Svil UTSW 18 5116055 missense probably damaging 1.00
R3777:Svil UTSW 18 5090855 missense probably damaging 0.97
R3779:Svil UTSW 18 5090855 missense probably damaging 0.97
R3797:Svil UTSW 18 5060534 missense probably benign 0.29
R4077:Svil UTSW 18 5063522 missense probably benign 0.03
R4350:Svil UTSW 18 5118154 missense probably damaging 1.00
R4379:Svil UTSW 18 5046909 missense probably damaging 1.00
R4488:Svil UTSW 18 5049067 missense probably damaging 1.00
R4777:Svil UTSW 18 5088813 missense probably damaging 0.99
R4825:Svil UTSW 18 5114564 missense probably damaging 1.00
R4921:Svil UTSW 18 5108631 missense probably damaging 1.00
R4969:Svil UTSW 18 5095516 missense probably damaging 1.00
R4975:Svil UTSW 18 5054025 missense possibly damaging 0.61
R4990:Svil UTSW 18 5056810 missense probably benign 0.05
R4991:Svil UTSW 18 5056810 missense probably benign 0.05
R5061:Svil UTSW 18 5048954 missense probably benign 0.02
R5271:Svil UTSW 18 5062329 missense probably benign 0.45
R5362:Svil UTSW 18 5057345 missense probably damaging 1.00
R5433:Svil UTSW 18 5059294 missense probably damaging 0.99
R5677:Svil UTSW 18 5046823 nonsense probably null
R5850:Svil UTSW 18 5098900 splice site probably null
R5868:Svil UTSW 18 5056854 splice site probably null
R5871:Svil UTSW 18 5103669 splice site probably null
R6061:Svil UTSW 18 5106724 missense probably damaging 1.00
R6062:Svil UTSW 18 5106724 missense probably damaging 1.00
R6063:Svil UTSW 18 5106724 missense probably damaging 1.00
R6065:Svil UTSW 18 5106724 missense probably damaging 1.00
R6066:Svil UTSW 18 5106724 missense probably damaging 1.00
R6114:Svil UTSW 18 5108639 missense probably damaging 1.00
R6115:Svil UTSW 18 5108675 missense probably damaging 0.99
R6117:Svil UTSW 18 5116016 missense probably damaging 1.00
R6302:Svil UTSW 18 5057432 missense probably benign 0.13
R6418:Svil UTSW 18 5040171 missense probably benign 0.26
R6441:Svil UTSW 18 5049323 missense probably benign
R6446:Svil UTSW 18 5057323 missense probably benign 0.09
R6455:Svil UTSW 18 5056629 missense possibly damaging 0.89
R6545:Svil UTSW 18 5108621 missense probably benign 0.00
R6692:Svil UTSW 18 5082853 missense probably damaging 1.00
R6730:Svil UTSW 18 5049311 missense probably benign 0.17
R6763:Svil UTSW 18 5056437 missense probably damaging 0.99
R6870:Svil UTSW 18 5063231 missense possibly damaging 0.86
R6916:Svil UTSW 18 5114682 utr 3 prime probably benign
R7134:Svil UTSW 18 5116080 missense probably damaging 1.00
R7190:Svil UTSW 18 5092937 missense probably benign 0.01
R7213:Svil UTSW 18 5094574 missense probably damaging 0.99
R7249:Svil UTSW 18 5056270 missense probably benign 0.01
R7249:Svil UTSW 18 5062247 missense probably damaging 0.99
R7421:Svil UTSW 18 5056109 missense probably benign 0.18
R7571:Svil UTSW 18 5114636 missense probably damaging 1.00
R7574:Svil UTSW 18 5095188 missense probably benign 0.16
R7645:Svil UTSW 18 5099663 missense probably damaging 1.00
R7925:Svil UTSW 18 5118357 missense probably benign 0.00
R8113:Svil UTSW 18 5062385 missense probably damaging 1.00
R8263:Svil UTSW 18 5108679 missense probably damaging 1.00
X0065:Svil UTSW 18 5062317 missense probably damaging 1.00
Z1177:Svil UTSW 18 5062344 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCAGGTTCAGAACACAGG -3'
(R):5'- ATGTAAAGACTGGGGCCTTCC -3'

Sequencing Primer
(F):5'- GTAAAACAGGGCAGCTTTGTCTC -3'
(R):5'- ATGTACTATTCTCTCTCCATGGACAG -3'
Posted On2017-02-10