Incidental Mutation 'R5876:Tm9sf3'
ID455565
Institutional Source Beutler Lab
Gene Symbol Tm9sf3
Ensembl Gene ENSMUSG00000025016
Gene Nametransmembrane 9 superfamily member 3
Synonyms1810073M23Rik, 2810031D16Rik, Smbp
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5876 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location41210842-41264004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41240584 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 260 (D260V)
Ref Sequence ENSEMBL: ENSMUSP00000025989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025989]
Predicted Effect probably damaging
Transcript: ENSMUST00000025989
AA Change: D260V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025989
Gene: ENSMUSG00000025016
AA Change: D260V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:EMP70 55 544 6.2e-164 PFAM
transmembrane domain 549 571 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,663,582 D64G possibly damaging Het
Ano2 T A 6: 126,039,279 M925K possibly damaging Het
Arnt2 T C 7: 84,347,512 T69A probably damaging Het
Asap2 T A 12: 21,212,809 N229K possibly damaging Het
Atp13a3 T A 16: 30,362,734 N23Y probably benign Het
Cbr4 G A 8: 61,490,593 G91R possibly damaging Het
Cdc27 A T 11: 104,515,418 C624S probably benign Het
Cdc42bpg T A 19: 6,310,815 I201N probably damaging Het
Cdh5 A G 8: 104,142,577 Y645C probably damaging Het
Celsr2 C T 3: 108,413,943 V518I probably damaging Het
Clca4b T C 3: 144,912,060 T761A possibly damaging Het
Cpne4 C A 9: 104,925,770 S204R probably damaging Het
Dcaf1 T C 9: 106,863,650 W1279R probably damaging Het
Dennd4a C T 9: 64,911,755 P1731S probably damaging Het
Dmxl1 T A 18: 49,870,984 V892D possibly damaging Het
Fam131b A G 6: 42,321,248 probably null Het
Fam83b T A 9: 76,491,850 D657V possibly damaging Het
Fam83e T A 7: 45,722,363 probably null Het
Fbxo4 A T 15: 3,977,819 I121N probably damaging Het
Gabrg2 A G 11: 41,968,820 S202P probably damaging Het
Gm10471 T C 5: 26,084,718 E237G probably damaging Het
Grid2 T A 6: 64,663,162 I788N probably damaging Het
Grik4 T A 9: 42,688,023 N53Y probably damaging Het
Hipk2 A C 6: 38,730,867 probably null Het
Hps5 T C 7: 46,789,196 T38A probably damaging Het
Hs1bp3 A G 12: 8,341,843 D315G possibly damaging Het
Kdm4a C T 4: 118,138,876 M985I probably damaging Het
Kdm5d A G Y: 900,525 Y190C probably damaging Het
Krt86 T C 15: 101,476,610 S295P probably damaging Het
Matr3 T A 18: 35,587,738 D413E probably benign Het
Mbd5 T A 2: 49,274,645 F319L probably damaging Het
Mcoln1 T A 8: 3,510,910 Y411N probably damaging Het
Mpdz C A 4: 81,285,474 E1863* probably null Het
Mrps9 A G 1: 42,895,378 E173G probably damaging Het
Olfr8 A T 10: 78,955,357 I51F probably benign Het
Osmr T C 15: 6,821,047 T692A probably benign Het
Pkhd1l1 A T 15: 44,578,588 H3641L possibly damaging Het
Pml T C 9: 58,233,182 T421A possibly damaging Het
Podxl A G 6: 31,528,456 probably null Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prkag3 A G 1: 74,748,816 probably benign Het
Proz A G 8: 13,073,448 R240G probably benign Het
Ptpn13 C A 5: 103,476,960 D43E probably damaging Het
Rbm5 T G 9: 107,760,326 K135N probably damaging Het
Ska1 G A 18: 74,197,528 T201M probably damaging Het
Slc35f5 A C 1: 125,587,363 probably null Het
Slc9a3 T C 13: 74,161,723 L510P probably damaging Het
Svil A G 18: 5,082,828 K1231E probably damaging Het
Tanc2 T C 11: 105,922,613 S1628P possibly damaging Het
Ttc9 G T 12: 81,631,622 R73L probably damaging Het
Vps13b A G 15: 35,917,061 I3684V probably damaging Het
Vps8 T C 16: 21,461,439 probably null Het
Vwa3b T A 1: 37,076,439 I328N probably damaging Het
Wdr1 C T 5: 38,530,023 V222M probably benign Het
Xpnpep1 T A 19: 52,997,008 T530S probably damaging Het
Zc3h6 C T 2: 128,993,277 S111F probably benign Het
Zfp768 G A 7: 127,344,546 P137S probably benign Het
Other mutations in Tm9sf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Tm9sf3 APN 19 41256276 missense probably damaging 1.00
IGL02176:Tm9sf3 APN 19 41246637 splice site probably benign
PIT4687001:Tm9sf3 UTSW 19 41218191 missense probably damaging 1.00
R0504:Tm9sf3 UTSW 19 41247892 splice site probably benign
R0564:Tm9sf3 UTSW 19 41245525 splice site probably benign
R0586:Tm9sf3 UTSW 19 41256143 critical splice donor site probably null
R1224:Tm9sf3 UTSW 19 41223195 missense probably damaging 1.00
R1533:Tm9sf3 UTSW 19 41238784 missense probably benign 0.00
R1646:Tm9sf3 UTSW 19 41223179 missense possibly damaging 0.79
R1748:Tm9sf3 UTSW 19 41256229 missense probably benign 0.01
R2022:Tm9sf3 UTSW 19 41238792 missense probably damaging 1.00
R2172:Tm9sf3 UTSW 19 41217420 missense probably damaging 1.00
R3844:Tm9sf3 UTSW 19 41217116 missense possibly damaging 0.95
R3878:Tm9sf3 UTSW 19 41246713 missense probably damaging 0.98
R4384:Tm9sf3 UTSW 19 41247933 missense probably damaging 1.00
R4385:Tm9sf3 UTSW 19 41247933 missense probably damaging 1.00
R4582:Tm9sf3 UTSW 19 41256166 missense probably damaging 1.00
R5497:Tm9sf3 UTSW 19 41215116 missense probably benign 0.03
R6305:Tm9sf3 UTSW 19 41245442 critical splice donor site probably null
R6924:Tm9sf3 UTSW 19 41218278 missense probably damaging 1.00
R6936:Tm9sf3 UTSW 19 41223199 missense probably benign 0.44
R7121:Tm9sf3 UTSW 19 41245505 nonsense probably null
R7287:Tm9sf3 UTSW 19 41217379 missense probably damaging 1.00
R7303:Tm9sf3 UTSW 19 41238759 missense probably damaging 0.97
R7677:Tm9sf3 UTSW 19 41221304 missense probably damaging 1.00
R8212:Tm9sf3 UTSW 19 41240635 missense probably damaging 0.99
R8220:Tm9sf3 UTSW 19 41215087 missense possibly damaging 0.80
X0026:Tm9sf3 UTSW 19 41246762 missense possibly damaging 0.91
X0026:Tm9sf3 UTSW 19 41246763 nonsense probably null
Z1088:Tm9sf3 UTSW 19 41232378 missense probably damaging 1.00
Z1176:Tm9sf3 UTSW 19 41238809 missense probably damaging 1.00
Z1177:Tm9sf3 UTSW 19 41245445 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGAGAGATGGTTCAGCAG -3'
(R):5'- GACTACTTATCCCCAGTGTGTC -3'

Sequencing Primer
(F):5'- GGACCCAGTTCAATTCTAAGTGC -3'
(R):5'- TCCCCAGTGTGTCTAAAGTTTAG -3'
Posted On2017-02-10