Incidental Mutation 'R0556:Ddx54'
ID45557
Institutional Source Beutler Lab
Gene Symbol Ddx54
Ensembl Gene ENSMUSG00000029599
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 54
Synonyms2410015A15Rik, APR-5, DP97
MMRRC Submission 038748-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0556 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location120612739-120628592 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 120619654 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031598]
Predicted Effect probably benign
Transcript: ENSMUST00000031598
SMART Domains Protein: ENSMUSP00000031598
Gene: ENSMUSG00000029599

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Blast:DEXDc 59 101 9e-19 BLAST
DEXDc 114 313 3.5e-58 SMART
HELICc 347 432 7.86e-20 SMART
low complexity region 628 646 N/A INTRINSIC
DBP10CT 706 766 1.45e-25 SMART
low complexity region 778 801 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201616
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202672
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The nucleolar protein encoded by this gene interacts in a hormone-dependent manner with nuclear receptors, and represses their transcriptional activity. Alternative splice variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik T A 17: 14,943,951 Y113* probably null Het
4930402F06Rik T C 2: 35,390,470 probably benign Het
4931406P16Rik T C 7: 34,239,797 T222A probably damaging Het
9530053A07Rik C T 7: 28,159,378 H2308Y probably benign Het
Acad11 A G 9: 104,115,302 E481G probably damaging Het
Aldh1a1 A T 19: 20,634,478 N389Y probably damaging Het
Bmpr2 C T 1: 59,815,328 T112M probably damaging Het
Bms1 A G 6: 118,413,179 Y227H probably damaging Het
Cab39 A G 1: 85,835,491 probably benign Het
Ccno T C 13: 112,988,286 probably null Het
Cct6b A G 11: 82,719,444 probably benign Het
Cd101 A C 3: 101,020,654 I37S probably damaging Het
Ces1a T C 8: 93,045,112 H19R probably benign Het
Clec16a A G 16: 10,638,785 probably null Het
Cntnap1 T C 11: 101,183,996 F831S probably benign Het
Col24a1 A G 3: 145,314,728 T287A possibly damaging Het
Colgalt2 C T 1: 152,471,813 probably benign Het
Cpd A G 11: 76,802,345 probably benign Het
Cyp3a16 C A 5: 145,455,980 M145I probably benign Het
Dock7 A T 4: 98,945,189 L1925Q probably damaging Het
Eif4g1 A T 16: 20,675,794 Y127F probably damaging Het
Erap1 T A 13: 74,660,325 V52E probably damaging Het
Fbxo6 G T 4: 148,146,175 T210N probably damaging Het
Gnat3 T G 5: 18,019,598 V332G probably damaging Het
Ift22 T A 5: 136,911,291 probably null Het
Igkv4-71 A G 6: 69,243,187 C109R probably damaging Het
Igsf10 A G 3: 59,328,875 L1295P probably benign Het
Itga4 T C 2: 79,325,639 I983T probably benign Het
Lhcgr A T 17: 88,772,063 V65D probably damaging Het
Mau2 G C 8: 70,042,432 T85R probably damaging Het
Morc2a T C 11: 3,681,809 probably null Het
Morc2b A T 17: 33,137,838 M320K probably benign Het
Ms4a18 C A 19: 11,013,701 V10F probably damaging Het
Mstn A T 1: 53,064,125 I207F probably benign Het
Mtor A G 4: 148,469,380 E812G possibly damaging Het
Myo1h A G 5: 114,319,791 Y121C probably damaging Het
Nov A T 15: 54,749,167 T191S probably damaging Het
Olfr1196 A C 2: 88,700,771 V186G possibly damaging Het
Olfr743 T C 14: 50,533,924 S171P probably benign Het
Olfr920 A T 9: 38,755,745 D19V possibly damaging Het
Plcd3 G A 11: 103,077,806 T353M probably damaging Het
Pnpla7 T A 2: 25,052,301 probably null Het
Ppp1r12b T A 1: 134,777,322 Y876F probably damaging Het
Prelid2 T A 18: 41,951,180 probably benign Het
Prickle1 A G 15: 93,500,781 L722P probably benign Het
Prr12 A G 7: 45,030,669 L1887P unknown Het
Ptk2b A G 14: 66,172,144 L481P probably damaging Het
Rgl3 T A 9: 21,975,844 K531* probably null Het
Sacs A G 14: 61,183,958 I115V probably damaging Het
Sept3 G T 15: 82,283,765 probably benign Het
Simc1 T C 13: 54,525,347 S503P probably benign Het
Stard9 T C 2: 120,698,923 V1887A probably benign Het
Synj2 T A 17: 6,037,955 L1427* probably null Het
Taar2 A G 10: 23,940,895 D111G probably damaging Het
Tlr5 A G 1: 182,974,151 N340S probably damaging Het
Tmco2 A G 4: 121,109,117 L14P probably damaging Het
Tnik A T 3: 28,625,218 D746V possibly damaging Het
Trip11 C A 12: 101,884,518 E811* probably null Het
Ttll9 T C 2: 152,973,606 probably null Het
Uchl1 A G 5: 66,682,481 E122G probably benign Het
Vwa3b C A 1: 37,164,485 probably benign Het
Zan T C 5: 137,454,220 N1533S unknown Het
Zfp687 G T 3: 95,010,408 D684E probably damaging Het
Other mutations in Ddx54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Ddx54 APN 5 120623810 critical splice donor site probably null
IGL01324:Ddx54 APN 5 120623638 missense probably benign 0.00
IGL01399:Ddx54 APN 5 120623903 nonsense probably null
IGL02052:Ddx54 APN 5 120625718 missense possibly damaging 0.93
IGL02095:Ddx54 APN 5 120623791 missense possibly damaging 0.81
IGL02370:Ddx54 APN 5 120619787 missense probably damaging 1.00
IGL02861:Ddx54 APN 5 120618130 splice site probably benign
R0521:Ddx54 UTSW 5 120626862 missense probably benign 0.00
R0723:Ddx54 UTSW 5 120623638 missense probably benign 0.00
R2968:Ddx54 UTSW 5 120618629 missense probably damaging 1.00
R4622:Ddx54 UTSW 5 120626423 missense probably damaging 1.00
R4853:Ddx54 UTSW 5 120623629 missense probably benign 0.12
R5168:Ddx54 UTSW 5 120617032 missense probably benign 0.00
R5169:Ddx54 UTSW 5 120623263 missense probably damaging 1.00
R5424:Ddx54 UTSW 5 120619861 critical splice donor site probably null
R5489:Ddx54 UTSW 5 120624721 missense probably benign
R5956:Ddx54 UTSW 5 120626367 unclassified probably benign
R5999:Ddx54 UTSW 5 120623580 missense probably benign 0.00
R6220:Ddx54 UTSW 5 120620689 missense probably benign 0.09
R6413:Ddx54 UTSW 5 120627062 missense probably benign
R6477:Ddx54 UTSW 5 120621778 missense probably damaging 1.00
R6702:Ddx54 UTSW 5 120626503 missense possibly damaging 0.52
R6783:Ddx54 UTSW 5 120618714 nonsense probably null
R6865:Ddx54 UTSW 5 120621827 critical splice donor site probably null
R7258:Ddx54 UTSW 5 120620747 missense probably damaging 1.00
R7260:Ddx54 UTSW 5 120626920 missense probably benign 0.21
R7488:Ddx54 UTSW 5 120624724 missense probably benign
R7887:Ddx54 UTSW 5 120627203 missense probably damaging 1.00
R7970:Ddx54 UTSW 5 120627203 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGGTAATTCCAAGCTGAGTCAC -3'
(R):5'- GCTTCAAGTTCATCTCCACAGCCAC -3'

Sequencing Primer
(F):5'- CTTGACCAGGTGTCTCACAGTAAG -3'
(R):5'- GCCACATGCACCAGACG -3'
Posted On2013-06-11