Incidental Mutation 'R5877:Camk1d'
ID455571
Institutional Source Beutler Lab
Gene Symbol Camk1d
Ensembl Gene ENSMUSG00000039145
Gene Namecalcium/calmodulin-dependent protein kinase ID
SynonymsE030025C11Rik, CaMKIdelta, CKLiK, A630059D12Rik
MMRRC Submission 044083-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5877 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location5293457-5714515 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5565665 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 62 (I62V)
Ref Sequence ENSEMBL: ENSMUSP00000110638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044009] [ENSMUST00000114987]
Predicted Effect probably benign
Transcript: ENSMUST00000044009
AA Change: I70V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000037028
Gene: ENSMUSG00000039145
AA Change: I70V

DomainStartEndE-ValueType
S_TKc 23 279 5.87e-112 SMART
low complexity region 326 343 N/A INTRINSIC
low complexity region 358 368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114987
AA Change: I62V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000110638
Gene: ENSMUSG00000039145
AA Change: I62V

DomainStartEndE-ValueType
S_TKc 23 271 1.35e-102 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 350 360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155927
Meta Mutation Damage Score 0.0799 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the calcium/calmodulin-dependent protein kinase 1 family, a subfamily of the serine/threonine kinases. The encoded protein is a component of the calcium-regulated calmodulin-dependent protein kinase cascade. It has been associated with multiple processes including regulation of granulocyte function, activation of CREB-dependent gene transcription, aldosterone synthesis, differentiation and activation of neutrophil cells, and apoptosis of erythroleukemia cells. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik G T 18: 77,643,206 probably null Het
Adam6b A T 12: 113,490,202 H213L probably damaging Het
Alk A G 17: 71,967,526 W597R probably damaging Het
Ash1l G A 3: 88,981,584 V257I probably benign Het
Atp9b C T 18: 80,752,789 V957I probably benign Het
Birc3 A C 9: 7,849,346 C576G probably damaging Het
Brca2 T C 5: 150,543,221 M2150T possibly damaging Het
C3ar1 T G 6: 122,850,622 D212A probably benign Het
Cacna1s T C 1: 136,100,667 F914S probably damaging Het
Caskin1 T C 17: 24,505,265 M1009T possibly damaging Het
Casp2 A G 6: 42,276,637 probably benign Het
Cd2bp2 T A 7: 127,194,799 Y106F probably damaging Het
Celsr3 G A 9: 108,845,727 C2763Y probably damaging Het
Cyp2g1 T G 7: 26,816,640 L310V possibly damaging Het
Dusp22 G A 13: 30,707,961 V99M probably damaging Het
Fam131b G A 6: 42,320,979 S92L probably benign Het
Fbxw10 A T 11: 62,857,716 N390Y probably damaging Het
Flg2 A T 3: 93,203,449 H928L unknown Het
Gapdhs T C 7: 30,732,347 T280A probably damaging Het
Hdac11 A G 6: 91,157,542 K50E probably damaging Het
Hif3a G T 7: 17,051,146 A181E probably damaging Het
Ikbkap A T 4: 56,787,807 W375R probably damaging Het
Itgb8 A G 12: 119,202,536 S87P probably benign Het
Klhl12 T A 1: 134,483,820 Y302* probably null Het
Lhx1 C A 11: 84,522,239 D30Y probably damaging Het
Mrpl40 A G 16: 18,872,385 Y148H probably damaging Het
Myh13 A T 11: 67,353,658 H1007L possibly damaging Het
Nhlrc2 T C 19: 56,570,584 I167T probably damaging Het
Nxpe3 A T 16: 55,866,201 I148K probably damaging Het
Odf2l A G 3: 145,129,010 probably null Het
Otud7b C T 3: 96,151,960 R347* probably null Het
P3h4 G T 11: 100,414,017 H181Q probably benign Het
P4htm T A 9: 108,583,733 Y180F possibly damaging Het
Pcna-ps2 A G 19: 9,284,099 I241V probably benign Het
Pcnx2 T C 8: 125,753,728 S1947G probably damaging Het
Piezo2 T C 18: 63,113,934 I336V probably benign Het
Plcd1 T C 9: 119,076,172 D157G probably damaging Het
Plekhm2 A C 4: 141,639,693 I212S probably damaging Het
Pmvk G T 3: 89,464,369 C57F probably benign Het
Pole T C 5: 110,332,463 S91P probably benign Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Ppp4r3b A T 11: 29,209,356 D570V probably damaging Het
Pxdn T A 12: 30,003,046 I1074N probably damaging Het
Ralgapa2 A T 2: 146,388,569 D1025E probably damaging Het
Ralgps1 A G 2: 33,243,628 probably benign Het
Rasal1 C T 5: 120,679,070 probably benign Het
Rps2 A T 17: 24,720,916 probably benign Het
Scn7a G C 2: 66,699,873 Y709* probably null Het
Skint1 T A 4: 112,021,523 C217* probably null Het
Slc50a1 T C 3: 89,269,153 Y82C probably damaging Het
Slc9a4 T C 1: 40,612,263 V567A probably benign Het
Snx27 A T 3: 94,502,963 W469R probably damaging Het
Sos2 A G 12: 69,596,795 L937P probably damaging Het
Ssh1 T C 5: 113,943,120 T728A probably benign Het
Tnfrsf8 G A 4: 145,292,687 R193C probably benign Het
Usp33 T A 3: 152,379,476 M583K possibly damaging Het
Usp33 G A 3: 152,379,596 C623Y probably damaging Het
Wdfy3 T C 5: 101,869,989 I2562V probably damaging Het
Wnk2 T C 13: 49,067,306 D1175G probably damaging Het
Zcchc11 T C 4: 108,512,923 V673A probably damaging Het
Zfp341 G A 2: 154,632,289 E338K probably damaging Het
Zfp398 A G 6: 47,840,704 probably benign Het
Zp2 T A 7: 120,133,339 K661N probably null Het
Other mutations in Camk1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Camk1d APN 2 5311073 splice site probably benign
IGL02138:Camk1d APN 2 5445084 nonsense probably null
IGL02826:Camk1d APN 2 5565760 missense possibly damaging 0.56
IGL02999:Camk1d APN 2 5354705 missense probably benign 0.44
R0432:Camk1d UTSW 2 5445135 missense probably damaging 1.00
R1180:Camk1d UTSW 2 5362025 nonsense probably null
R1448:Camk1d UTSW 2 5362025 nonsense probably null
R1628:Camk1d UTSW 2 5311037 missense probably damaging 0.99
R1850:Camk1d UTSW 2 5362015 missense probably benign 0.08
R1998:Camk1d UTSW 2 5362025 nonsense probably null
R2000:Camk1d UTSW 2 5362025 nonsense probably null
R2513:Camk1d UTSW 2 5714236 start codon destroyed probably null 0.15
R4065:Camk1d UTSW 2 5565773 missense probably damaging 1.00
R4201:Camk1d UTSW 2 5354776 missense probably benign 0.03
R4581:Camk1d UTSW 2 5354704 missense probably benign 0.21
R4760:Camk1d UTSW 2 5362056 missense probably damaging 1.00
R4894:Camk1d UTSW 2 5354728 missense probably damaging 1.00
R5001:Camk1d UTSW 2 5313101 missense possibly damaging 0.50
R5394:Camk1d UTSW 2 5303366 missense probably benign 0.10
R5754:Camk1d UTSW 2 5445097 missense probably benign 0.10
R5754:Camk1d UTSW 2 5445099 missense probably damaging 1.00
R6444:Camk1d UTSW 2 5313145 missense probably damaging 1.00
R7315:Camk1d UTSW 2 5339230 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCCACATGAATAGCAGC -3'
(R):5'- CACTGCGATCATGCTCCTTG -3'

Sequencing Primer
(F):5'- CACATGAATAGCAGCTGTCATCTG -3'
(R):5'- GCGATCATGCTCCTTGTTACTGTG -3'
Posted On2017-02-10