Incidental Mutation 'R5877:Ralgps1'
ID455572
Institutional Source Beutler Lab
Gene Symbol Ralgps1
Ensembl Gene ENSMUSG00000038831
Gene NameRal GEF with PH domain and SH3 binding motif 1
SynonymsRALGPS1A, 5830418G11Rik, RALGEF2
MMRRC Submission 044083-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R5877 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location33133417-33371486 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 33243628 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004208] [ENSMUST00000042615] [ENSMUST00000091039] [ENSMUST00000113165] [ENSMUST00000131298] [ENSMUST00000193373]
Predicted Effect probably benign
Transcript: ENSMUST00000004208
SMART Domains Protein: ENSMUSP00000004208
Gene: ENSMUSG00000004105

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 77 113 N/A INTRINSIC
coiled coil region 152 180 N/A INTRINSIC
low complexity region 205 228 N/A INTRINSIC
FBG 273 488 3.62e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042615
SMART Domains Protein: ENSMUSP00000048451
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 273 4.59e-86 SMART
low complexity region 286 301 N/A INTRINSIC
PH 372 485 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091039
SMART Domains Protein: ENSMUSP00000088563
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
PH 460 573 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113165
SMART Domains Protein: ENSMUSP00000108790
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
PH 459 572 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131298
SMART Domains Protein: ENSMUSP00000118363
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
PH 390 503 1.87e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143252
Predicted Effect probably benign
Transcript: ENSMUST00000193373
SMART Domains Protein: ENSMUSP00000142084
Gene: ENSMUSG00000004105

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fibrinogen_C 49 112 4.2e-21 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik G T 18: 77,643,206 probably null Het
Adam6b A T 12: 113,490,202 H213L probably damaging Het
Alk A G 17: 71,967,526 W597R probably damaging Het
Ash1l G A 3: 88,981,584 V257I probably benign Het
Atp9b C T 18: 80,752,789 V957I probably benign Het
Birc3 A C 9: 7,849,346 C576G probably damaging Het
Brca2 T C 5: 150,543,221 M2150T possibly damaging Het
C3ar1 T G 6: 122,850,622 D212A probably benign Het
Cacna1s T C 1: 136,100,667 F914S probably damaging Het
Camk1d T C 2: 5,565,665 I62V probably benign Het
Caskin1 T C 17: 24,505,265 M1009T possibly damaging Het
Casp2 A G 6: 42,276,637 probably benign Het
Cd2bp2 T A 7: 127,194,799 Y106F probably damaging Het
Celsr3 G A 9: 108,845,727 C2763Y probably damaging Het
Cyp2g1 T G 7: 26,816,640 L310V possibly damaging Het
Dusp22 G A 13: 30,707,961 V99M probably damaging Het
Fam131b G A 6: 42,320,979 S92L probably benign Het
Fbxw10 A T 11: 62,857,716 N390Y probably damaging Het
Flg2 A T 3: 93,203,449 H928L unknown Het
Gapdhs T C 7: 30,732,347 T280A probably damaging Het
Hdac11 A G 6: 91,157,542 K50E probably damaging Het
Hif3a G T 7: 17,051,146 A181E probably damaging Het
Ikbkap A T 4: 56,787,807 W375R probably damaging Het
Itgb8 A G 12: 119,202,536 S87P probably benign Het
Klhl12 T A 1: 134,483,820 Y302* probably null Het
Lhx1 C A 11: 84,522,239 D30Y probably damaging Het
Mrpl40 A G 16: 18,872,385 Y148H probably damaging Het
Myh13 A T 11: 67,353,658 H1007L possibly damaging Het
Nhlrc2 T C 19: 56,570,584 I167T probably damaging Het
Nxpe3 A T 16: 55,866,201 I148K probably damaging Het
Odf2l A G 3: 145,129,010 probably null Het
Otud7b C T 3: 96,151,960 R347* probably null Het
P3h4 G T 11: 100,414,017 H181Q probably benign Het
P4htm T A 9: 108,583,733 Y180F possibly damaging Het
Pcna-ps2 A G 19: 9,284,099 I241V probably benign Het
Pcnx2 T C 8: 125,753,728 S1947G probably damaging Het
Piezo2 T C 18: 63,113,934 I336V probably benign Het
Plcd1 T C 9: 119,076,172 D157G probably damaging Het
Plekhm2 A C 4: 141,639,693 I212S probably damaging Het
Pmvk G T 3: 89,464,369 C57F probably benign Het
Pole T C 5: 110,332,463 S91P probably benign Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Ppp4r3b A T 11: 29,209,356 D570V probably damaging Het
Pxdn T A 12: 30,003,046 I1074N probably damaging Het
Ralgapa2 A T 2: 146,388,569 D1025E probably damaging Het
Rasal1 C T 5: 120,679,070 probably benign Het
Rps2 A T 17: 24,720,916 probably benign Het
Scn7a G C 2: 66,699,873 Y709* probably null Het
Skint1 T A 4: 112,021,523 C217* probably null Het
Slc50a1 T C 3: 89,269,153 Y82C probably damaging Het
Slc9a4 T C 1: 40,612,263 V567A probably benign Het
Snx27 A T 3: 94,502,963 W469R probably damaging Het
Sos2 A G 12: 69,596,795 L937P probably damaging Het
Ssh1 T C 5: 113,943,120 T728A probably benign Het
Tnfrsf8 G A 4: 145,292,687 R193C probably benign Het
Usp33 T A 3: 152,379,476 M583K possibly damaging Het
Usp33 G A 3: 152,379,596 C623Y probably damaging Het
Wdfy3 T C 5: 101,869,989 I2562V probably damaging Het
Wnk2 T C 13: 49,067,306 D1175G probably damaging Het
Zcchc11 T C 4: 108,512,923 V673A probably damaging Het
Zfp341 G A 2: 154,632,289 E338K probably damaging Het
Zfp398 A G 6: 47,840,704 probably benign Het
Zp2 T A 7: 120,133,339 K661N probably null Het
Other mutations in Ralgps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Ralgps1 APN 2 33137682 makesense probably null
IGL00780:Ralgps1 APN 2 33273627 missense probably damaging 1.00
IGL00951:Ralgps1 APN 2 33273602 missense probably damaging 1.00
IGL01358:Ralgps1 APN 2 33143049 missense possibly damaging 0.62
IGL02346:Ralgps1 APN 2 33157770 critical splice donor site probably null
IGL02481:Ralgps1 APN 2 33340729 missense probably benign 0.04
IGL03281:Ralgps1 APN 2 33172416 critical splice donor site probably null
IGL03284:Ralgps1 APN 2 33146565 splice site probably benign
IGL03377:Ralgps1 APN 2 33172461 missense probably damaging 1.00
R0007:Ralgps1 UTSW 2 33143389 missense probably damaging 0.97
R0029:Ralgps1 UTSW 2 33141019 missense probably benign
R0309:Ralgps1 UTSW 2 33157923 missense probably benign
R0320:Ralgps1 UTSW 2 33141015 missense possibly damaging 0.59
R0622:Ralgps1 UTSW 2 33174447 nonsense probably null
R1277:Ralgps1 UTSW 2 33174425 missense possibly damaging 0.51
R1797:Ralgps1 UTSW 2 33340711 critical splice donor site probably null
R2921:Ralgps1 UTSW 2 33143070 missense probably damaging 0.99
R3123:Ralgps1 UTSW 2 33158956 missense possibly damaging 0.81
R3124:Ralgps1 UTSW 2 33158956 missense possibly damaging 0.81
R4741:Ralgps1 UTSW 2 33336587 missense probably benign 0.00
R4894:Ralgps1 UTSW 2 33143103 missense possibly damaging 0.71
R5148:Ralgps1 UTSW 2 33158987 missense probably damaging 1.00
R5255:Ralgps1 UTSW 2 33276159 missense probably damaging 1.00
R6330:Ralgps1 UTSW 2 33174443 missense probably damaging 1.00
R6908:Ralgps1 UTSW 2 33143100 missense probably benign 0.17
R7252:Ralgps1 UTSW 2 33168188 missense probably benign 0.12
R7299:Ralgps1 UTSW 2 33157873 missense probably benign
R7366:Ralgps1 UTSW 2 33324688 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGTGACCACATCTTCCTGC -3'
(R):5'- GTCGGAAACTGGCATACTCAG -3'

Sequencing Primer
(F):5'- CCTGCCTTTGAGAAGTTACAGAATCC -3'
(R):5'- TGGCATACTCAGCAAAGACTTTACG -3'
Posted On2017-02-10