Incidental Mutation 'R5877:Pmvk'
ID455578
Institutional Source Beutler Lab
Gene Symbol Pmvk
Ensembl Gene ENSMUSG00000027952
Gene Namephosphomevalonate kinase
Synonyms
MMRRC Submission 044083-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R5877 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89454541-89469013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 89464369 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 57 (C57F)
Ref Sequence ENSEMBL: ENSMUSP00000139116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029564] [ENSMUST00000107410] [ENSMUST00000184515] [ENSMUST00000198440]
Predicted Effect probably benign
Transcript: ENSMUST00000029564
AA Change: C78F

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000029564
Gene: ENSMUSG00000027952
AA Change: C78F

DomainStartEndE-ValueType
Pfam:P-mevalo_kinase 14 124 1.4e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107410
AA Change: C78F

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103033
Gene: ENSMUSG00000027952
AA Change: C78F

DomainStartEndE-ValueType
Pfam:P-mevalo_kinase 14 129 9.3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184515
AA Change: C57F

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139116
Gene: ENSMUSG00000027952
AA Change: C57F

DomainStartEndE-ValueType
Pfam:P-mevalo_kinase 5 108 3.9e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198440
AA Change: C3F

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000143154
Gene: ENSMUSG00000027952
AA Change: C3F

DomainStartEndE-ValueType
Pfam:P-mevalo_kinase 1 54 5.6e-19 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peroxisomal enzyme that is a member of the galactokinase, homoserine kinase, mevalonate kinase, and phosphomevalonate kinase (GHMP) family of ATP-dependent enzymes. The encoded protein catalyzes the conversion of mevalonate 5-phosphate to mevalonate 5-diphosphate, which is the fifth step in the mevalonate pathway of isoprenoid biosynthesis. Mutations in this gene are linked to certain types of porokeratosis including disseminated superficial porokeratosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik G T 18: 77,643,206 probably null Het
Adam6b A T 12: 113,490,202 H213L probably damaging Het
Alk A G 17: 71,967,526 W597R probably damaging Het
Ash1l G A 3: 88,981,584 V257I probably benign Het
Atp9b C T 18: 80,752,789 V957I probably benign Het
Birc3 A C 9: 7,849,346 C576G probably damaging Het
Brca2 T C 5: 150,543,221 M2150T possibly damaging Het
C3ar1 T G 6: 122,850,622 D212A probably benign Het
Cacna1s T C 1: 136,100,667 F914S probably damaging Het
Camk1d T C 2: 5,565,665 I62V probably benign Het
Caskin1 T C 17: 24,505,265 M1009T possibly damaging Het
Casp2 A G 6: 42,276,637 probably benign Het
Cd2bp2 T A 7: 127,194,799 Y106F probably damaging Het
Celsr3 G A 9: 108,845,727 C2763Y probably damaging Het
Cyp2g1 T G 7: 26,816,640 L310V possibly damaging Het
Dusp22 G A 13: 30,707,961 V99M probably damaging Het
Fam131b G A 6: 42,320,979 S92L probably benign Het
Fbxw10 A T 11: 62,857,716 N390Y probably damaging Het
Flg2 A T 3: 93,203,449 H928L unknown Het
Gapdhs T C 7: 30,732,347 T280A probably damaging Het
Hdac11 A G 6: 91,157,542 K50E probably damaging Het
Hif3a G T 7: 17,051,146 A181E probably damaging Het
Ikbkap A T 4: 56,787,807 W375R probably damaging Het
Itgb8 A G 12: 119,202,536 S87P probably benign Het
Klhl12 T A 1: 134,483,820 Y302* probably null Het
Lhx1 C A 11: 84,522,239 D30Y probably damaging Het
Mrpl40 A G 16: 18,872,385 Y148H probably damaging Het
Myh13 A T 11: 67,353,658 H1007L possibly damaging Het
Nhlrc2 T C 19: 56,570,584 I167T probably damaging Het
Nxpe3 A T 16: 55,866,201 I148K probably damaging Het
Odf2l A G 3: 145,129,010 probably null Het
Otud7b C T 3: 96,151,960 R347* probably null Het
P3h4 G T 11: 100,414,017 H181Q probably benign Het
P4htm T A 9: 108,583,733 Y180F possibly damaging Het
Pcna-ps2 A G 19: 9,284,099 I241V probably benign Het
Pcnx2 T C 8: 125,753,728 S1947G probably damaging Het
Piezo2 T C 18: 63,113,934 I336V probably benign Het
Plcd1 T C 9: 119,076,172 D157G probably damaging Het
Plekhm2 A C 4: 141,639,693 I212S probably damaging Het
Pole T C 5: 110,332,463 S91P probably benign Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Ppp4r3b A T 11: 29,209,356 D570V probably damaging Het
Pxdn T A 12: 30,003,046 I1074N probably damaging Het
Ralgapa2 A T 2: 146,388,569 D1025E probably damaging Het
Ralgps1 A G 2: 33,243,628 probably benign Het
Rasal1 C T 5: 120,679,070 probably benign Het
Rps2 A T 17: 24,720,916 probably benign Het
Scn7a G C 2: 66,699,873 Y709* probably null Het
Skint1 T A 4: 112,021,523 C217* probably null Het
Slc50a1 T C 3: 89,269,153 Y82C probably damaging Het
Slc9a4 T C 1: 40,612,263 V567A probably benign Het
Snx27 A T 3: 94,502,963 W469R probably damaging Het
Sos2 A G 12: 69,596,795 L937P probably damaging Het
Ssh1 T C 5: 113,943,120 T728A probably benign Het
Tnfrsf8 G A 4: 145,292,687 R193C probably benign Het
Usp33 T A 3: 152,379,476 M583K possibly damaging Het
Usp33 G A 3: 152,379,596 C623Y probably damaging Het
Wdfy3 T C 5: 101,869,989 I2562V probably damaging Het
Wnk2 T C 13: 49,067,306 D1175G probably damaging Het
Zcchc11 T C 4: 108,512,923 V673A probably damaging Het
Zfp341 G A 2: 154,632,289 E338K probably damaging Het
Zfp398 A G 6: 47,840,704 probably benign Het
Zp2 T A 7: 120,133,339 K661N probably null Het
Other mutations in Pmvk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Pmvk APN 3 89467583 missense probably damaging 1.00
R2090:Pmvk UTSW 3 89461882 missense possibly damaging 0.53
R3034:Pmvk UTSW 3 89468517 missense probably damaging 0.99
R5337:Pmvk UTSW 3 89468571 missense probably benign 0.36
R5469:Pmvk UTSW 3 89467682 critical splice donor site probably null
R5842:Pmvk UTSW 3 89467620 missense probably damaging 1.00
R7657:Pmvk UTSW 3 89468851 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACTGCCTTTGTCACTGTCCAAG -3'
(R):5'- CAGGAGGACTTCTGAGATGC -3'

Sequencing Primer
(F):5'- TCACTGTCCAAGCTGGCTAGTG -3'
(R):5'- ACTTCTGAGATGCTAGAGAGGTG -3'
Posted On2017-02-10