Incidental Mutation 'R5877:Tnfrsf8'
ID455590
Institutional Source Beutler Lab
Gene Symbol Tnfrsf8
Ensembl Gene ENSMUSG00000028602
Gene Nametumor necrosis factor receptor superfamily, member 8
SynonymsCD30
MMRRC Submission 044083-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5877 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location145267137-145315164 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 145292687 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 193 (R193C)
Ref Sequence ENSEMBL: ENSMUSP00000118714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030339] [ENSMUST00000123027]
Predicted Effect probably benign
Transcript: ENSMUST00000030339
AA Change: R193C

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000030339
Gene: ENSMUSG00000028602
AA Change: R193C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
TNFR 29 65 2.33e0 SMART
TNFR 69 105 5.51e-7 SMART
TNFR 107 146 2.87e-5 SMART
low complexity region 149 161 N/A INTRINSIC
transmembrane domain 288 310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123027
AA Change: R193C

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000118714
Gene: ENSMUSG00000028602
AA Change: R193C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
TNFR 29 65 2.33e0 SMART
TNFR 69 105 5.51e-7 SMART
TNFR 107 146 2.87e-5 SMART
low complexity region 149 161 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is expressed by activated, but not by resting, T and B cells. TRAF2 and TRAF5 can interact with this receptor, and mediate the signal transduction that leads to the activation of NF-kappaB. This receptor is a positive regulator of apoptosis, and also has been shown to limit the proliferative potential of autoreactive CD8 effector T cells and protect the body against autoimmunity. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display an enlarged thymus, impaired activation-induced death of double-positive thymocytes after CD3 cross-linking, and decreased susceptibility to graft versus host disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik G T 18: 77,643,206 probably null Het
Adam6b A T 12: 113,490,202 H213L probably damaging Het
Alk A G 17: 71,967,526 W597R probably damaging Het
Ash1l G A 3: 88,981,584 V257I probably benign Het
Atp9b C T 18: 80,752,789 V957I probably benign Het
Birc3 A C 9: 7,849,346 C576G probably damaging Het
Brca2 T C 5: 150,543,221 M2150T possibly damaging Het
C3ar1 T G 6: 122,850,622 D212A probably benign Het
Cacna1s T C 1: 136,100,667 F914S probably damaging Het
Camk1d T C 2: 5,565,665 I62V probably benign Het
Caskin1 T C 17: 24,505,265 M1009T possibly damaging Het
Casp2 A G 6: 42,276,637 probably benign Het
Cd2bp2 T A 7: 127,194,799 Y106F probably damaging Het
Celsr3 G A 9: 108,845,727 C2763Y probably damaging Het
Cyp2g1 T G 7: 26,816,640 L310V possibly damaging Het
Dusp22 G A 13: 30,707,961 V99M probably damaging Het
Fam131b G A 6: 42,320,979 S92L probably benign Het
Fbxw10 A T 11: 62,857,716 N390Y probably damaging Het
Flg2 A T 3: 93,203,449 H928L unknown Het
Gapdhs T C 7: 30,732,347 T280A probably damaging Het
Hdac11 A G 6: 91,157,542 K50E probably damaging Het
Hif3a G T 7: 17,051,146 A181E probably damaging Het
Ikbkap A T 4: 56,787,807 W375R probably damaging Het
Itgb8 A G 12: 119,202,536 S87P probably benign Het
Klhl12 T A 1: 134,483,820 Y302* probably null Het
Lhx1 C A 11: 84,522,239 D30Y probably damaging Het
Mrpl40 A G 16: 18,872,385 Y148H probably damaging Het
Myh13 A T 11: 67,353,658 H1007L possibly damaging Het
Nhlrc2 T C 19: 56,570,584 I167T probably damaging Het
Nxpe3 A T 16: 55,866,201 I148K probably damaging Het
Odf2l A G 3: 145,129,010 probably null Het
Otud7b C T 3: 96,151,960 R347* probably null Het
P3h4 G T 11: 100,414,017 H181Q probably benign Het
P4htm T A 9: 108,583,733 Y180F possibly damaging Het
Pcna-ps2 A G 19: 9,284,099 I241V probably benign Het
Pcnx2 T C 8: 125,753,728 S1947G probably damaging Het
Piezo2 T C 18: 63,113,934 I336V probably benign Het
Plcd1 T C 9: 119,076,172 D157G probably damaging Het
Plekhm2 A C 4: 141,639,693 I212S probably damaging Het
Pmvk G T 3: 89,464,369 C57F probably benign Het
Pole T C 5: 110,332,463 S91P probably benign Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Ppp4r3b A T 11: 29,209,356 D570V probably damaging Het
Pxdn T A 12: 30,003,046 I1074N probably damaging Het
Ralgapa2 A T 2: 146,388,569 D1025E probably damaging Het
Ralgps1 A G 2: 33,243,628 probably benign Het
Rasal1 C T 5: 120,679,070 probably benign Het
Rps2 A T 17: 24,720,916 probably benign Het
Scn7a G C 2: 66,699,873 Y709* probably null Het
Skint1 T A 4: 112,021,523 C217* probably null Het
Slc50a1 T C 3: 89,269,153 Y82C probably damaging Het
Slc9a4 T C 1: 40,612,263 V567A probably benign Het
Snx27 A T 3: 94,502,963 W469R probably damaging Het
Sos2 A G 12: 69,596,795 L937P probably damaging Het
Ssh1 T C 5: 113,943,120 T728A probably benign Het
Usp33 G A 3: 152,379,596 C623Y probably damaging Het
Usp33 T A 3: 152,379,476 M583K possibly damaging Het
Wdfy3 T C 5: 101,869,989 I2562V probably damaging Het
Wnk2 T C 13: 49,067,306 D1175G probably damaging Het
Zcchc11 T C 4: 108,512,923 V673A probably damaging Het
Zfp341 G A 2: 154,632,289 E338K probably damaging Het
Zfp398 A G 6: 47,840,704 probably benign Het
Zp2 T A 7: 120,133,339 K661N probably null Het
Other mutations in Tnfrsf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Tnfrsf8 APN 4 145292591 splice site probably null
IGL02815:Tnfrsf8 APN 4 145298778 missense possibly damaging 0.68
IGL02819:Tnfrsf8 APN 4 145269133 missense probably damaging 1.00
IGL03033:Tnfrsf8 APN 4 145292649 missense possibly damaging 0.86
IGL03105:Tnfrsf8 APN 4 145298784 missense probably damaging 1.00
IGL02837:Tnfrsf8 UTSW 4 145268998 missense probably benign 0.10
R0114:Tnfrsf8 UTSW 4 145288047 missense possibly damaging 0.95
R0326:Tnfrsf8 UTSW 4 145288459 missense possibly damaging 0.64
R0594:Tnfrsf8 UTSW 4 145296861 missense probably damaging 1.00
R0639:Tnfrsf8 UTSW 4 145288027 missense probably benign 0.24
R0826:Tnfrsf8 UTSW 4 145285138 splice site probably benign
R3056:Tnfrsf8 UTSW 4 145285325 critical splice donor site probably null
R4700:Tnfrsf8 UTSW 4 145303122 missense probably damaging 0.99
R4765:Tnfrsf8 UTSW 4 145296877 missense probably benign 0.19
R5149:Tnfrsf8 UTSW 4 145303105 missense possibly damaging 0.53
R5452:Tnfrsf8 UTSW 4 145292644 missense possibly damaging 0.96
R5632:Tnfrsf8 UTSW 4 145292633 missense possibly damaging 0.68
R5673:Tnfrsf8 UTSW 4 145285335 missense probably benign 0.14
R6243:Tnfrsf8 UTSW 4 145303101 missense possibly damaging 0.61
R6259:Tnfrsf8 UTSW 4 145277524 critical splice donor site probably null
R6326:Tnfrsf8 UTSW 4 145269224 missense probably damaging 1.00
R6603:Tnfrsf8 UTSW 4 145292598 missense possibly damaging 0.70
R7025:Tnfrsf8 UTSW 4 145274403 missense possibly damaging 0.87
R7156:Tnfrsf8 UTSW 4 145315084 start codon destroyed unknown
R7313:Tnfrsf8 UTSW 4 145274382 missense probably benign 0.33
R7505:Tnfrsf8 UTSW 4 145269115 missense probably damaging 1.00
Z1177:Tnfrsf8 UTSW 4 145292709 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GAGATGCTCTTCTGTTCCTACTTGG -3'
(R):5'- GCTCATAGCAGGGCACATAG -3'

Sequencing Primer
(F):5'- GTTCCTACTTGGCAAGCTGC -3'
(R):5'- CAGGGCACATAGGGGCTG -3'
Posted On2017-02-10