Incidental Mutation 'R5877:Cd2bp2'
ID455604
Institutional Source Beutler Lab
Gene Symbol Cd2bp2
Ensembl Gene ENSMUSG00000042502
Gene NameCD2 antigen (cytoplasmic tail) binding protein 2
Synonyms
MMRRC Submission 044083-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R5877 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127191660-127196050 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127194799 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 106 (Y106F)
Ref Sequence ENSEMBL: ENSMUSP00000145779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035771] [ENSMUST00000120705] [ENSMUST00000166791] [ENSMUST00000205316] [ENSMUST00000205321] [ENSMUST00000205355] [ENSMUST00000206026] [ENSMUST00000206081] [ENSMUST00000206587]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035771
AA Change: Y106F

PolyPhen 2 Score 0.701 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000044790
Gene: ENSMUSG00000042502
AA Change: Y106F

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
low complexity region 156 165 N/A INTRINSIC
low complexity region 172 193 N/A INTRINSIC
GYF 282 339 7.35e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120705
SMART Domains Protein: ENSMUSP00000113307
Gene: ENSMUSG00000042492

DomainStartEndE-ValueType
low complexity region 10 33 N/A INTRINSIC
low complexity region 66 81 N/A INTRINSIC
low complexity region 129 143 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
low complexity region 207 227 N/A INTRINSIC
Blast:TBC 274 305 6e-10 BLAST
TBC 343 557 8.23e-57 SMART
low complexity region 632 678 N/A INTRINSIC
coiled coil region 701 769 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153857
Predicted Effect probably damaging
Transcript: ENSMUST00000166791
AA Change: Y106F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132963
Gene: ENSMUSG00000042502
AA Change: Y106F

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
low complexity region 156 165 N/A INTRINSIC
low complexity region 172 193 N/A INTRINSIC
GYF 282 339 7.35e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175164
Predicted Effect probably damaging
Transcript: ENSMUST00000205316
AA Change: Y106F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000205321
AA Change: Y106F

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000205355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205525
Predicted Effect probably benign
Transcript: ENSMUST00000205620
Predicted Effect probably damaging
Transcript: ENSMUST00000206026
AA Change: Y106F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206081
Predicted Effect probably damaging
Transcript: ENSMUST00000206587
AA Change: Y106F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bi-functional protein. In the cytoplasm, the encoded protein binds the cytoplasmic tail of human surface antigen CD2 via its C-terminal GYF domain, and regulate CD2-triggered T lymphocyte activation. In the nucleus, this protein is a component of the U5 small nuclear ribonucleoprotein complex and is involved in RNA splicing. A pseudogene has been identified on chromosome 7. Alternative splicing results in multiple transcript variants but their biological validity has not been determined. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik G T 18: 77,643,206 probably null Het
Adam6b A T 12: 113,490,202 H213L probably damaging Het
Alk A G 17: 71,967,526 W597R probably damaging Het
Ash1l G A 3: 88,981,584 V257I probably benign Het
Atp9b C T 18: 80,752,789 V957I probably benign Het
Birc3 A C 9: 7,849,346 C576G probably damaging Het
Brca2 T C 5: 150,543,221 M2150T possibly damaging Het
C3ar1 T G 6: 122,850,622 D212A probably benign Het
Cacna1s T C 1: 136,100,667 F914S probably damaging Het
Camk1d T C 2: 5,565,665 I62V probably benign Het
Caskin1 T C 17: 24,505,265 M1009T possibly damaging Het
Casp2 A G 6: 42,276,637 probably benign Het
Celsr3 G A 9: 108,845,727 C2763Y probably damaging Het
Cyp2g1 T G 7: 26,816,640 L310V possibly damaging Het
Dusp22 G A 13: 30,707,961 V99M probably damaging Het
Fam131b G A 6: 42,320,979 S92L probably benign Het
Fbxw10 A T 11: 62,857,716 N390Y probably damaging Het
Flg2 A T 3: 93,203,449 H928L unknown Het
Gapdhs T C 7: 30,732,347 T280A probably damaging Het
Hdac11 A G 6: 91,157,542 K50E probably damaging Het
Hif3a G T 7: 17,051,146 A181E probably damaging Het
Ikbkap A T 4: 56,787,807 W375R probably damaging Het
Itgb8 A G 12: 119,202,536 S87P probably benign Het
Klhl12 T A 1: 134,483,820 Y302* probably null Het
Lhx1 C A 11: 84,522,239 D30Y probably damaging Het
Mrpl40 A G 16: 18,872,385 Y148H probably damaging Het
Myh13 A T 11: 67,353,658 H1007L possibly damaging Het
Nhlrc2 T C 19: 56,570,584 I167T probably damaging Het
Nxpe3 A T 16: 55,866,201 I148K probably damaging Het
Odf2l A G 3: 145,129,010 probably null Het
Otud7b C T 3: 96,151,960 R347* probably null Het
P3h4 G T 11: 100,414,017 H181Q probably benign Het
P4htm T A 9: 108,583,733 Y180F possibly damaging Het
Pcna-ps2 A G 19: 9,284,099 I241V probably benign Het
Pcnx2 T C 8: 125,753,728 S1947G probably damaging Het
Piezo2 T C 18: 63,113,934 I336V probably benign Het
Plcd1 T C 9: 119,076,172 D157G probably damaging Het
Plekhm2 A C 4: 141,639,693 I212S probably damaging Het
Pmvk G T 3: 89,464,369 C57F probably benign Het
Pole T C 5: 110,332,463 S91P probably benign Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Ppp4r3b A T 11: 29,209,356 D570V probably damaging Het
Pxdn T A 12: 30,003,046 I1074N probably damaging Het
Ralgapa2 A T 2: 146,388,569 D1025E probably damaging Het
Ralgps1 A G 2: 33,243,628 probably benign Het
Rasal1 C T 5: 120,679,070 probably benign Het
Rps2 A T 17: 24,720,916 probably benign Het
Scn7a G C 2: 66,699,873 Y709* probably null Het
Skint1 T A 4: 112,021,523 C217* probably null Het
Slc50a1 T C 3: 89,269,153 Y82C probably damaging Het
Slc9a4 T C 1: 40,612,263 V567A probably benign Het
Snx27 A T 3: 94,502,963 W469R probably damaging Het
Sos2 A G 12: 69,596,795 L937P probably damaging Het
Ssh1 T C 5: 113,943,120 T728A probably benign Het
Tnfrsf8 G A 4: 145,292,687 R193C probably benign Het
Usp33 T A 3: 152,379,476 M583K possibly damaging Het
Usp33 G A 3: 152,379,596 C623Y probably damaging Het
Wdfy3 T C 5: 101,869,989 I2562V probably damaging Het
Wnk2 T C 13: 49,067,306 D1175G probably damaging Het
Zcchc11 T C 4: 108,512,923 V673A probably damaging Het
Zfp341 G A 2: 154,632,289 E338K probably damaging Het
Zfp398 A G 6: 47,840,704 probably benign Het
Zp2 T A 7: 120,133,339 K661N probably null Het
Other mutations in Cd2bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0020:Cd2bp2 UTSW 7 127193824 missense probably damaging 1.00
R0201:Cd2bp2 UTSW 7 127193828 missense probably damaging 1.00
R0550:Cd2bp2 UTSW 7 127193824 missense probably damaging 1.00
R0674:Cd2bp2 UTSW 7 127194836 missense probably damaging 1.00
R1929:Cd2bp2 UTSW 7 127193878 missense probably benign 0.22
R2187:Cd2bp2 UTSW 7 127194791 missense probably benign 0.06
R6049:Cd2bp2 UTSW 7 127193835 missense probably damaging 1.00
R6109:Cd2bp2 UTSW 7 127194815 missense probably damaging 1.00
R7008:Cd2bp2 UTSW 7 127195395 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GTCTGAAACCTGGTGCTTATCAG -3'
(R):5'- TCCGAAGCGTTAACTGAGTTGG -3'

Sequencing Primer
(F):5'- TTATCAGGGGGCCGTTCC -3'
(R):5'- CAAGCCTTCAGGATGGAGGTG -3'
Posted On2017-02-10