Incidental Mutation 'R5877:Plcd1'
ID455609
Institutional Source Beutler Lab
Gene Symbol Plcd1
Ensembl Gene ENSMUSG00000010660
Gene Namephospholipase C, delta 1
SynonymsPLC-delta 1
MMRRC Submission 044083-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.445) question?
Stock #R5877 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119071527-119093502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119076172 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 157 (D157G)
Ref Sequence ENSEMBL: ENSMUSP00000149676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010804] [ENSMUST00000010804] [ENSMUST00000051386] [ENSMUST00000074734] [ENSMUST00000126251] [ENSMUST00000141185] [ENSMUST00000213464] [ENSMUST00000214470]
Predicted Effect possibly damaging
Transcript: ENSMUST00000010804
AA Change: D157G

PolyPhen 2 Score 0.493 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000010804
Gene: ENSMUSG00000010660
AA Change: D157G

DomainStartEndE-ValueType
PH 22 132 9.41e-10 SMART
EFh 144 172 2.87e-2 SMART
EFh 180 208 9.34e1 SMART
Pfam:EF-hand_like 213 295 1.2e-23 PFAM
PLCXc 296 440 5.47e-94 SMART
low complexity region 461 472 N/A INTRINSIC
PLCYc 492 609 1.22e-68 SMART
C2 630 735 1.78e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000010804
AA Change: D157G

PolyPhen 2 Score 0.493 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000010804
Gene: ENSMUSG00000010660
AA Change: D157G

DomainStartEndE-ValueType
PH 22 132 9.41e-10 SMART
EFh 144 172 2.87e-2 SMART
EFh 180 208 9.34e1 SMART
Pfam:EF-hand_like 213 295 1.2e-23 PFAM
PLCXc 296 440 5.47e-94 SMART
low complexity region 461 472 N/A INTRINSIC
PLCYc 492 609 1.22e-68 SMART
C2 630 735 1.78e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051386
SMART Domains Protein: ENSMUSP00000061731
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
GEL 14 114 4.59e-13 SMART
GEL 135 227 4.18e-16 SMART
GEL 252 348 8.35e-25 SMART
GEL 391 488 7.92e-17 SMART
GEL 508 594 4.38e-19 SMART
GEL 613 706 7.8e-16 SMART
VHP 824 859 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074734
SMART Domains Protein: ENSMUSP00000074294
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
GEL 14 114 4.59e-13 SMART
GEL 135 227 4.18e-16 SMART
GEL 252 348 8.35e-25 SMART
GEL 391 488 7.92e-17 SMART
GEL 508 594 4.38e-19 SMART
VHP 740 775 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126251
SMART Domains Protein: ENSMUSP00000116262
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
Blast:GEL 1 56 9e-21 BLAST
GEL 63 149 4.38e-19 SMART
GEL 168 261 7.8e-16 SMART
VHP 357 392 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141185
SMART Domains Protein: ENSMUSP00000116546
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
GEL 7 104 7.92e-17 SMART
GEL 124 210 4.38e-19 SMART
GEL 229 322 7.8e-16 SMART
VHP 440 475 2.12e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153454
Predicted Effect probably damaging
Transcript: ENSMUST00000213464
AA Change: D157G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000214470
AA Change: D183G

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214491
Meta Mutation Damage Score 0.3068 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phospholipase C family. Phospholipase C isozymes play critical roles in intracellular signal transduction by catalyzing the hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP2) into the second messengers diacylglycerol (DAG) and inositol triphosphate (IP3). The encoded protein functions as a tumor suppressor in several types of cancer, and mutations in this gene are a cause of hereditary leukonychia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene show reduced body size and various abnormalities of the skin and hair including alopecia, epidermal hyperplasia, enlarged sebaceous glands, various kinds of cysts, and skin tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik G T 18: 77,643,206 probably null Het
Adam6b A T 12: 113,490,202 H213L probably damaging Het
Alk A G 17: 71,967,526 W597R probably damaging Het
Ash1l G A 3: 88,981,584 V257I probably benign Het
Atp9b C T 18: 80,752,789 V957I probably benign Het
Birc3 A C 9: 7,849,346 C576G probably damaging Het
Brca2 T C 5: 150,543,221 M2150T possibly damaging Het
C3ar1 T G 6: 122,850,622 D212A probably benign Het
Cacna1s T C 1: 136,100,667 F914S probably damaging Het
Camk1d T C 2: 5,565,665 I62V probably benign Het
Caskin1 T C 17: 24,505,265 M1009T possibly damaging Het
Casp2 A G 6: 42,276,637 probably benign Het
Cd2bp2 T A 7: 127,194,799 Y106F probably damaging Het
Celsr3 G A 9: 108,845,727 C2763Y probably damaging Het
Cyp2g1 T G 7: 26,816,640 L310V possibly damaging Het
Dusp22 G A 13: 30,707,961 V99M probably damaging Het
Fam131b G A 6: 42,320,979 S92L probably benign Het
Fbxw10 A T 11: 62,857,716 N390Y probably damaging Het
Flg2 A T 3: 93,203,449 H928L unknown Het
Gapdhs T C 7: 30,732,347 T280A probably damaging Het
Hdac11 A G 6: 91,157,542 K50E probably damaging Het
Hif3a G T 7: 17,051,146 A181E probably damaging Het
Ikbkap A T 4: 56,787,807 W375R probably damaging Het
Itgb8 A G 12: 119,202,536 S87P probably benign Het
Klhl12 T A 1: 134,483,820 Y302* probably null Het
Lhx1 C A 11: 84,522,239 D30Y probably damaging Het
Mrpl40 A G 16: 18,872,385 Y148H probably damaging Het
Myh13 A T 11: 67,353,658 H1007L possibly damaging Het
Nhlrc2 T C 19: 56,570,584 I167T probably damaging Het
Nxpe3 A T 16: 55,866,201 I148K probably damaging Het
Odf2l A G 3: 145,129,010 probably null Het
Otud7b C T 3: 96,151,960 R347* probably null Het
P3h4 G T 11: 100,414,017 H181Q probably benign Het
P4htm T A 9: 108,583,733 Y180F possibly damaging Het
Pcna-ps2 A G 19: 9,284,099 I241V probably benign Het
Pcnx2 T C 8: 125,753,728 S1947G probably damaging Het
Piezo2 T C 18: 63,113,934 I336V probably benign Het
Plekhm2 A C 4: 141,639,693 I212S probably damaging Het
Pmvk G T 3: 89,464,369 C57F probably benign Het
Pole T C 5: 110,332,463 S91P probably benign Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Ppp4r3b A T 11: 29,209,356 D570V probably damaging Het
Pxdn T A 12: 30,003,046 I1074N probably damaging Het
Ralgapa2 A T 2: 146,388,569 D1025E probably damaging Het
Ralgps1 A G 2: 33,243,628 probably benign Het
Rasal1 C T 5: 120,679,070 probably benign Het
Rps2 A T 17: 24,720,916 probably benign Het
Scn7a G C 2: 66,699,873 Y709* probably null Het
Skint1 T A 4: 112,021,523 C217* probably null Het
Slc50a1 T C 3: 89,269,153 Y82C probably damaging Het
Slc9a4 T C 1: 40,612,263 V567A probably benign Het
Snx27 A T 3: 94,502,963 W469R probably damaging Het
Sos2 A G 12: 69,596,795 L937P probably damaging Het
Ssh1 T C 5: 113,943,120 T728A probably benign Het
Tnfrsf8 G A 4: 145,292,687 R193C probably benign Het
Usp33 T A 3: 152,379,476 M583K possibly damaging Het
Usp33 G A 3: 152,379,596 C623Y probably damaging Het
Wdfy3 T C 5: 101,869,989 I2562V probably damaging Het
Wnk2 T C 13: 49,067,306 D1175G probably damaging Het
Zcchc11 T C 4: 108,512,923 V673A probably damaging Het
Zfp341 G A 2: 154,632,289 E338K probably damaging Het
Zfp398 A G 6: 47,840,704 probably benign Het
Zp2 T A 7: 120,133,339 K661N probably null Het
Other mutations in Plcd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Plcd1 APN 9 119076178 missense probably damaging 1.00
IGL01634:Plcd1 APN 9 119073789 missense probably damaging 0.99
IGL01992:Plcd1 APN 9 119075985 missense probably benign
IGL02246:Plcd1 APN 9 119072609 missense probably benign 0.16
IGL02266:Plcd1 APN 9 119074787 splice site probably benign
IGL02270:Plcd1 APN 9 119084641 missense probably damaging 1.00
IGL02281:Plcd1 APN 9 119074773 missense probably benign 0.00
IGL02324:Plcd1 APN 9 119072642 missense probably damaging 0.97
IGL02936:Plcd1 APN 9 119074199 missense probably damaging 1.00
IGL03348:Plcd1 APN 9 119072490 missense possibly damaging 0.91
R0366:Plcd1 UTSW 9 119081136 missense probably damaging 0.99
R1765:Plcd1 UTSW 9 119071806 missense probably damaging 1.00
R3704:Plcd1 UTSW 9 119076209 missense possibly damaging 0.85
R5143:Plcd1 UTSW 9 119074451 nonsense probably null
R5587:Plcd1 UTSW 9 119073832 missense probably benign
R6043:Plcd1 UTSW 9 119072599 missense probably damaging 1.00
R6103:Plcd1 UTSW 9 119072041 missense probably benign 0.16
R6338:Plcd1 UTSW 9 119074991 missense probably damaging 1.00
R6339:Plcd1 UTSW 9 119074991 missense probably damaging 1.00
R6496:Plcd1 UTSW 9 119072641 missense possibly damaging 0.79
R6516:Plcd1 UTSW 9 119076203 missense probably damaging 0.99
R6646:Plcd1 UTSW 9 119075032 missense probably damaging 0.99
R6854:Plcd1 UTSW 9 119074321 splice site probably null
R6955:Plcd1 UTSW 9 119071856 missense probably benign 0.01
R7382:Plcd1 UTSW 9 119074691 missense probably damaging 1.00
R7577:Plcd1 UTSW 9 119072254 missense possibly damaging 0.94
R8089:Plcd1 UTSW 9 119075992 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AATCTCCTCATCCTCCAGCGAG -3'
(R):5'- AGACCCATCCATAGTAAGGAAGGC -3'

Sequencing Primer
(F):5'- GGAGTGGTCACATTCCTGCAAAC -3'
(R):5'- CATAGTAAGGAAGGCCTCCCG -3'
Posted On2017-02-10