Incidental Mutation 'R0556:Bms1'
ID45562
Institutional Source Beutler Lab
Gene Symbol Bms1
Ensembl Gene ENSMUSG00000030138
Gene NameBMS1, ribosome biogenesis factor
SynonymsBms1l
MMRRC Submission 038748-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0556 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location118383381-118419474 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118413179 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 227 (Y227H)
Ref Sequence ENSEMBL: ENSMUSP00000032237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032237]
Predicted Effect probably damaging
Transcript: ENSMUST00000032237
AA Change: Y227H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032237
Gene: ENSMUSG00000030138
AA Change: Y227H

DomainStartEndE-ValueType
SCOP:d1f5na2 78 187 2e-5 SMART
low complexity region 190 205 N/A INTRINSIC
AARP2CN 231 317 2.15e-42 SMART
low complexity region 436 460 N/A INTRINSIC
low complexity region 462 481 N/A INTRINSIC
low complexity region 498 514 N/A INTRINSIC
low complexity region 518 537 N/A INTRINSIC
low complexity region 590 613 N/A INTRINSIC
low complexity region 642 661 N/A INTRINSIC
Blast:AAA 663 740 9e-20 BLAST
DUF663 816 1108 6.7e-173 SMART
coiled coil region 1223 1257 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205207
Meta Mutation Damage Score 0.5604 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a ribosome assembly protein. A similar protein in yeast functions in 35S-rRNA processing, which includes a series of cleavage steps critical for formation of 40S ribosomes. Related pseudogenes exist on chromosomes 2, 9, 10, 15, 16, and 22.[provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik T A 17: 14,943,951 Y113* probably null Het
4930402F06Rik T C 2: 35,390,470 probably benign Het
4931406P16Rik T C 7: 34,239,797 T222A probably damaging Het
9530053A07Rik C T 7: 28,159,378 H2308Y probably benign Het
Acad11 A G 9: 104,115,302 E481G probably damaging Het
Aldh1a1 A T 19: 20,634,478 N389Y probably damaging Het
Bmpr2 C T 1: 59,815,328 T112M probably damaging Het
Cab39 A G 1: 85,835,491 probably benign Het
Ccno T C 13: 112,988,286 probably null Het
Cct6b A G 11: 82,719,444 probably benign Het
Cd101 A C 3: 101,020,654 I37S probably damaging Het
Ces1a T C 8: 93,045,112 H19R probably benign Het
Clec16a A G 16: 10,638,785 probably null Het
Cntnap1 T C 11: 101,183,996 F831S probably benign Het
Col24a1 A G 3: 145,314,728 T287A possibly damaging Het
Colgalt2 C T 1: 152,471,813 probably benign Het
Cpd A G 11: 76,802,345 probably benign Het
Cyp3a16 C A 5: 145,455,980 M145I probably benign Het
Ddx54 T A 5: 120,619,654 probably benign Het
Dock7 A T 4: 98,945,189 L1925Q probably damaging Het
Eif4g1 A T 16: 20,675,794 Y127F probably damaging Het
Erap1 T A 13: 74,660,325 V52E probably damaging Het
Fbxo6 G T 4: 148,146,175 T210N probably damaging Het
Gnat3 T G 5: 18,019,598 V332G probably damaging Het
Ift22 T A 5: 136,911,291 probably null Het
Igkv4-71 A G 6: 69,243,187 C109R probably damaging Het
Igsf10 A G 3: 59,328,875 L1295P probably benign Het
Itga4 T C 2: 79,325,639 I983T probably benign Het
Lhcgr A T 17: 88,772,063 V65D probably damaging Het
Mau2 G C 8: 70,042,432 T85R probably damaging Het
Morc2a T C 11: 3,681,809 probably null Het
Morc2b A T 17: 33,137,838 M320K probably benign Het
Ms4a18 C A 19: 11,013,701 V10F probably damaging Het
Mstn A T 1: 53,064,125 I207F probably benign Het
Mtor A G 4: 148,469,380 E812G possibly damaging Het
Myo1h A G 5: 114,319,791 Y121C probably damaging Het
Nov A T 15: 54,749,167 T191S probably damaging Het
Olfr1196 A C 2: 88,700,771 V186G possibly damaging Het
Olfr743 T C 14: 50,533,924 S171P probably benign Het
Olfr920 A T 9: 38,755,745 D19V possibly damaging Het
Plcd3 G A 11: 103,077,806 T353M probably damaging Het
Pnpla7 T A 2: 25,052,301 probably null Het
Ppp1r12b T A 1: 134,777,322 Y876F probably damaging Het
Prelid2 T A 18: 41,951,180 probably benign Het
Prickle1 A G 15: 93,500,781 L722P probably benign Het
Prr12 A G 7: 45,030,669 L1887P unknown Het
Ptk2b A G 14: 66,172,144 L481P probably damaging Het
Rgl3 T A 9: 21,975,844 K531* probably null Het
Sacs A G 14: 61,183,958 I115V probably damaging Het
Sept3 G T 15: 82,283,765 probably benign Het
Simc1 T C 13: 54,525,347 S503P probably benign Het
Stard9 T C 2: 120,698,923 V1887A probably benign Het
Synj2 T A 17: 6,037,955 L1427* probably null Het
Taar2 A G 10: 23,940,895 D111G probably damaging Het
Tlr5 A G 1: 182,974,151 N340S probably damaging Het
Tmco2 A G 4: 121,109,117 L14P probably damaging Het
Tnik A T 3: 28,625,218 D746V possibly damaging Het
Trip11 C A 12: 101,884,518 E811* probably null Het
Ttll9 T C 2: 152,973,606 probably null Het
Uchl1 A G 5: 66,682,481 E122G probably benign Het
Vwa3b C A 1: 37,164,485 probably benign Het
Zan T C 5: 137,454,220 N1533S unknown Het
Zfp687 G T 3: 95,010,408 D684E probably damaging Het
Other mutations in Bms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Bms1 APN 6 118404583 missense probably benign 0.01
IGL00763:Bms1 APN 6 118418402 splice site probably benign
IGL00839:Bms1 APN 6 118405291 missense probably benign 0.30
IGL02005:Bms1 APN 6 118404585 missense probably damaging 1.00
IGL02271:Bms1 APN 6 118389329 missense probably benign 0.10
IGL02403:Bms1 APN 6 118405224 missense possibly damaging 0.89
IGL02474:Bms1 APN 6 118416519 missense probably benign 0.00
IGL03230:Bms1 APN 6 118418561 missense possibly damaging 0.88
IGL03277:Bms1 APN 6 118405122 missense probably benign
PIT4508001:Bms1 UTSW 6 118383806 missense probably benign 0.03
R0028:Bms1 UTSW 6 118416519 missense probably benign 0.00
R0056:Bms1 UTSW 6 118405229 missense probably benign 0.00
R0056:Bms1 UTSW 6 118405229 missense probably benign 0.00
R0276:Bms1 UTSW 6 118408134 missense possibly damaging 0.87
R0295:Bms1 UTSW 6 118389337 missense probably benign 0.04
R0360:Bms1 UTSW 6 118405290 missense probably benign 0.13
R1078:Bms1 UTSW 6 118405221 missense probably benign 0.00
R1583:Bms1 UTSW 6 118389389 splice site probably benign
R1815:Bms1 UTSW 6 118383781 missense probably damaging 1.00
R1957:Bms1 UTSW 6 118392978 missense probably damaging 0.98
R2045:Bms1 UTSW 6 118392627 missense probably damaging 1.00
R2511:Bms1 UTSW 6 118391153 splice site probably null
R4293:Bms1 UTSW 6 118405347 splice site probably null
R4296:Bms1 UTSW 6 118404999 missense probably damaging 0.96
R4467:Bms1 UTSW 6 118383847 missense probably damaging 0.99
R4688:Bms1 UTSW 6 118392706 missense probably damaging 1.00
R4718:Bms1 UTSW 6 118403235 missense possibly damaging 0.91
R5015:Bms1 UTSW 6 118404263 nonsense probably null
R5327:Bms1 UTSW 6 118405218 missense possibly damaging 0.53
R5489:Bms1 UTSW 6 118413745 missense possibly damaging 0.64
R5511:Bms1 UTSW 6 118388887 missense possibly damaging 0.85
R5636:Bms1 UTSW 6 118388825 missense probably benign 0.00
R5815:Bms1 UTSW 6 118404279 missense probably damaging 1.00
R6245:Bms1 UTSW 6 118396836 missense probably damaging 0.96
R6299:Bms1 UTSW 6 118418515 missense probably damaging 0.98
R6389:Bms1 UTSW 6 118403235 missense possibly damaging 0.91
R6838:Bms1 UTSW 6 118416494 missense probably benign 0.00
R7129:Bms1 UTSW 6 118403161 nonsense probably null
R7414:Bms1 UTSW 6 118383745 missense possibly damaging 0.93
R7811:Bms1 UTSW 6 118403138 missense probably damaging 0.99
R7883:Bms1 UTSW 6 118388774 missense probably benign 0.04
R8046:Bms1 UTSW 6 118408144 missense probably benign
R8068:Bms1 UTSW 6 118413750 missense probably damaging 1.00
R8098:Bms1 UTSW 6 118384258 missense probably damaging 0.98
R8176:Bms1 UTSW 6 118418450 missense probably damaging 1.00
X0067:Bms1 UTSW 6 118404834 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TTGGAACTCAGCCCTCTATGCATTG -3'
(R):5'- GAAGGCAGCCAGCTTTGAAAACAC -3'

Sequencing Primer
(F):5'- TGCAGGCAATAGGTACTATCACTG -3'
(R):5'- CCAAACAGTAACTTCCATTGACCTTG -3'
Posted On2013-06-11