Incidental Mutation 'R5877:Wnk2'
ID455620
Institutional Source Beutler Lab
Gene Symbol Wnk2
Ensembl Gene ENSMUSG00000037989
Gene NameWNK lysine deficient protein kinase 2
SynonymsESTM15, X83337, 1810073P09Rik
MMRRC Submission 044083-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.321) question?
Stock #R5877 (G1)
Quality Score181
Status Validated
Chromosome13
Chromosomal Location49036303-49148014 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49067306 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1175 (D1175G)
Ref Sequence ENSEMBL: ENSMUSP00000105723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035538] [ENSMUST00000049265] [ENSMUST00000091623] [ENSMUST00000110096] [ENSMUST00000110097] [ENSMUST00000159559] [ENSMUST00000160087] [ENSMUST00000162403] [ENSMUST00000162581]
Predicted Effect probably benign
Transcript: ENSMUST00000035538
AA Change: D1273G

PolyPhen 2 Score 0.215 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000047231
Gene: ENSMUSG00000037989
AA Change: D1273G

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.5e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.6e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 6.72e-6 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
low complexity region 2033 2053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000049265
AA Change: D1273G

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000049327
Gene: ENSMUSG00000037989
AA Change: D1273G

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
S_TKc 195 453 3.3e-19 SMART
Pfam:OSR1_C 474 511 5.6e-19 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 9.51e-6 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
internal_repeat_2 1611 1703 2.12e-5 PROSPERO
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
internal_repeat_2 1923 2023 2.12e-5 PROSPERO
low complexity region 2069 2089 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000091623
AA Change: D1273G

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000089212
Gene: ENSMUSG00000037989
AA Change: D1273G

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 1.6e-41 PFAM
Pfam:Pkinase 195 453 1e-54 PFAM
Pfam:OSR1_C 474 511 4e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 1.52e-5 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
internal_repeat_2 1611 1713 7.41e-5 PROSPERO
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
internal_repeat_2 1923 2027 7.41e-5 PROSPERO
low complexity region 2117 2137 N/A INTRINSIC
low complexity region 2191 2202 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110096
AA Change: D1175G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105723
Gene: ENSMUSG00000037989
AA Change: D1175G

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.6e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.6e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 1015 1038 N/A INTRINSIC
internal_repeat_1 1064 1087 2.89e-5 PROSPERO
low complexity region 1177 1194 N/A INTRINSIC
low complexity region 1219 1255 N/A INTRINSIC
low complexity region 1331 1343 N/A INTRINSIC
low complexity region 1351 1359 N/A INTRINSIC
low complexity region 1366 1391 N/A INTRINSIC
low complexity region 1489 1498 N/A INTRINSIC
low complexity region 1721 1732 N/A INTRINSIC
coiled coil region 1737 1768 N/A INTRINSIC
low complexity region 2018 2038 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110097
AA Change: D1273G

PolyPhen 2 Score 0.446 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105724
Gene: ENSMUSG00000037989
AA Change: D1273G

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.7e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.8e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 1.16e-5 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
internal_repeat_2 1611 1713 5.74e-5 PROSPERO
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
internal_repeat_2 1923 2027 5.74e-5 PROSPERO
low complexity region 2117 2137 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159559
AA Change: D1261G

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123915
Gene: ENSMUSG00000037989
AA Change: D1261G

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.7e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.8e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 736 N/A INTRINSIC
low complexity region 759 791 N/A INTRINSIC
low complexity region 809 819 N/A INTRINSIC
low complexity region 828 842 N/A INTRINSIC
low complexity region 863 878 N/A INTRINSIC
low complexity region 926 942 N/A INTRINSIC
low complexity region 971 1002 N/A INTRINSIC
low complexity region 1009 1036 N/A INTRINSIC
low complexity region 1101 1124 N/A INTRINSIC
internal_repeat_1 1150 1173 7.19e-6 PROSPERO
low complexity region 1263 1280 N/A INTRINSIC
low complexity region 1305 1341 N/A INTRINSIC
low complexity region 1417 1429 N/A INTRINSIC
low complexity region 1437 1445 N/A INTRINSIC
low complexity region 1452 1477 N/A INTRINSIC
low complexity region 1575 1585 N/A INTRINSIC
internal_repeat_2 1599 1701 3.66e-5 PROSPERO
low complexity region 1808 1819 N/A INTRINSIC
coiled coil region 1824 1855 N/A INTRINSIC
internal_repeat_2 1911 2015 3.66e-5 PROSPERO
low complexity region 2105 2125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159633
Predicted Effect possibly damaging
Transcript: ENSMUST00000160087
AA Change: D415G

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124614
Gene: ENSMUSG00000037989
AA Change: D415G

DomainStartEndE-ValueType
low complexity region 61 71 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
low complexity region 115 130 N/A INTRINSIC
low complexity region 178 194 N/A INTRINSIC
low complexity region 255 278 N/A INTRINSIC
low complexity region 417 434 N/A INTRINSIC
low complexity region 459 495 N/A INTRINSIC
low complexity region 571 583 N/A INTRINSIC
low complexity region 591 599 N/A INTRINSIC
low complexity region 606 631 N/A INTRINSIC
low complexity region 729 738 N/A INTRINSIC
low complexity region 961 972 N/A INTRINSIC
coiled coil region 977 1008 N/A INTRINSIC
low complexity region 1258 1278 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162403
AA Change: D1163G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000125539
Gene: ENSMUSG00000037989
AA Change: D1163G

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.3e-42 PFAM
Pfam:Pkinase 195 453 1.6e-56 PFAM
Pfam:OSR1_C 474 511 5.3e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 736 N/A INTRINSIC
low complexity region 759 791 N/A INTRINSIC
low complexity region 809 819 N/A INTRINSIC
low complexity region 828 842 N/A INTRINSIC
low complexity region 863 878 N/A INTRINSIC
low complexity region 926 942 N/A INTRINSIC
low complexity region 1003 1026 N/A INTRINSIC
internal_repeat_1 1052 1075 1.05e-5 PROSPERO
low complexity region 1165 1182 N/A INTRINSIC
low complexity region 1207 1243 N/A INTRINSIC
low complexity region 1319 1331 N/A INTRINSIC
low complexity region 1339 1347 N/A INTRINSIC
low complexity region 1354 1379 N/A INTRINSIC
low complexity region 1477 1487 N/A INTRINSIC
internal_repeat_2 1501 1593 2.32e-5 PROSPERO
low complexity region 1710 1721 N/A INTRINSIC
coiled coil region 1726 1757 N/A INTRINSIC
internal_repeat_2 1813 1913 2.32e-5 PROSPERO
low complexity region 1959 1979 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162581
AA Change: D1273G

PolyPhen 2 Score 0.215 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000125448
Gene: ENSMUSG00000037989
AA Change: D1273G

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.5e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.6e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 6.72e-6 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
low complexity region 2033 2053 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic serine-threonine kinase that belongs to the protein kinase superfamily. The protein plays an important role in the regulation of electrolyte homeostasis, cell signaling survival, and proliferation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik G T 18: 77,643,206 probably null Het
Adam6b A T 12: 113,490,202 H213L probably damaging Het
Alk A G 17: 71,967,526 W597R probably damaging Het
Ash1l G A 3: 88,981,584 V257I probably benign Het
Atp9b C T 18: 80,752,789 V957I probably benign Het
Birc3 A C 9: 7,849,346 C576G probably damaging Het
Brca2 T C 5: 150,543,221 M2150T possibly damaging Het
C3ar1 T G 6: 122,850,622 D212A probably benign Het
Cacna1s T C 1: 136,100,667 F914S probably damaging Het
Camk1d T C 2: 5,565,665 I62V probably benign Het
Caskin1 T C 17: 24,505,265 M1009T possibly damaging Het
Casp2 A G 6: 42,276,637 probably benign Het
Cd2bp2 T A 7: 127,194,799 Y106F probably damaging Het
Celsr3 G A 9: 108,845,727 C2763Y probably damaging Het
Cyp2g1 T G 7: 26,816,640 L310V possibly damaging Het
Dusp22 G A 13: 30,707,961 V99M probably damaging Het
Fam131b G A 6: 42,320,979 S92L probably benign Het
Fbxw10 A T 11: 62,857,716 N390Y probably damaging Het
Flg2 A T 3: 93,203,449 H928L unknown Het
Gapdhs T C 7: 30,732,347 T280A probably damaging Het
Hdac11 A G 6: 91,157,542 K50E probably damaging Het
Hif3a G T 7: 17,051,146 A181E probably damaging Het
Ikbkap A T 4: 56,787,807 W375R probably damaging Het
Itgb8 A G 12: 119,202,536 S87P probably benign Het
Klhl12 T A 1: 134,483,820 Y302* probably null Het
Lhx1 C A 11: 84,522,239 D30Y probably damaging Het
Mrpl40 A G 16: 18,872,385 Y148H probably damaging Het
Myh13 A T 11: 67,353,658 H1007L possibly damaging Het
Nhlrc2 T C 19: 56,570,584 I167T probably damaging Het
Nxpe3 A T 16: 55,866,201 I148K probably damaging Het
Odf2l A G 3: 145,129,010 probably null Het
Otud7b C T 3: 96,151,960 R347* probably null Het
P3h4 G T 11: 100,414,017 H181Q probably benign Het
P4htm T A 9: 108,583,733 Y180F possibly damaging Het
Pcna-ps2 A G 19: 9,284,099 I241V probably benign Het
Pcnx2 T C 8: 125,753,728 S1947G probably damaging Het
Piezo2 T C 18: 63,113,934 I336V probably benign Het
Plcd1 T C 9: 119,076,172 D157G probably damaging Het
Plekhm2 A C 4: 141,639,693 I212S probably damaging Het
Pmvk G T 3: 89,464,369 C57F probably benign Het
Pole T C 5: 110,332,463 S91P probably benign Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Ppp4r3b A T 11: 29,209,356 D570V probably damaging Het
Pxdn T A 12: 30,003,046 I1074N probably damaging Het
Ralgapa2 A T 2: 146,388,569 D1025E probably damaging Het
Ralgps1 A G 2: 33,243,628 probably benign Het
Rasal1 C T 5: 120,679,070 probably benign Het
Rps2 A T 17: 24,720,916 probably benign Het
Scn7a G C 2: 66,699,873 Y709* probably null Het
Skint1 T A 4: 112,021,523 C217* probably null Het
Slc50a1 T C 3: 89,269,153 Y82C probably damaging Het
Slc9a4 T C 1: 40,612,263 V567A probably benign Het
Snx27 A T 3: 94,502,963 W469R probably damaging Het
Sos2 A G 12: 69,596,795 L937P probably damaging Het
Ssh1 T C 5: 113,943,120 T728A probably benign Het
Tnfrsf8 G A 4: 145,292,687 R193C probably benign Het
Usp33 T A 3: 152,379,476 M583K possibly damaging Het
Usp33 G A 3: 152,379,596 C623Y probably damaging Het
Wdfy3 T C 5: 101,869,989 I2562V probably damaging Het
Zcchc11 T C 4: 108,512,923 V673A probably damaging Het
Zfp341 G A 2: 154,632,289 E338K probably damaging Het
Zfp398 A G 6: 47,840,704 probably benign Het
Zp2 T A 7: 120,133,339 K661N probably null Het
Other mutations in Wnk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Wnk2 APN 13 49068192 missense possibly damaging 0.89
IGL01575:Wnk2 APN 13 49146676 missense probably damaging 1.00
IGL01601:Wnk2 APN 13 49076562 missense probably damaging 1.00
IGL01775:Wnk2 APN 13 49071110 missense probably damaging 1.00
IGL02013:Wnk2 APN 13 49082034 missense possibly damaging 0.46
IGL02016:Wnk2 APN 13 49056905 missense probably damaging 1.00
IGL02167:Wnk2 APN 13 49071125 critical splice acceptor site probably null
IGL02174:Wnk2 APN 13 49057167 missense probably damaging 1.00
IGL02210:Wnk2 APN 13 49090869 missense probably damaging 0.98
IGL02228:Wnk2 APN 13 49056940 missense probably damaging 1.00
IGL02282:Wnk2 APN 13 49068125 missense probably damaging 1.00
IGL02319:Wnk2 APN 13 49061438 missense possibly damaging 0.73
IGL02394:Wnk2 APN 13 49081899 splice site probably null
IGL02624:Wnk2 APN 13 49102802 missense probably damaging 1.00
IGL02743:Wnk2 APN 13 49095444 missense probably damaging 1.00
IGL03012:Wnk2 APN 13 49044389 missense probably damaging 0.99
IGL03166:Wnk2 APN 13 49071044 nonsense probably null
R0034:Wnk2 UTSW 13 49068080 missense possibly damaging 0.64
R0385:Wnk2 UTSW 13 49068128 missense probably damaging 1.00
R0423:Wnk2 UTSW 13 49095418 missense possibly damaging 0.91
R0504:Wnk2 UTSW 13 49085394 missense possibly damaging 0.92
R0504:Wnk2 UTSW 13 49085396 missense probably damaging 1.00
R0653:Wnk2 UTSW 13 49057016 missense possibly damaging 0.85
R1135:Wnk2 UTSW 13 49076558 missense probably damaging 1.00
R1445:Wnk2 UTSW 13 49071110 missense probably damaging 1.00
R1464:Wnk2 UTSW 13 49081975 missense probably damaging 1.00
R1464:Wnk2 UTSW 13 49081975 missense probably damaging 1.00
R1468:Wnk2 UTSW 13 49082095 missense probably damaging 0.99
R1468:Wnk2 UTSW 13 49082095 missense probably damaging 0.99
R1480:Wnk2 UTSW 13 49057232 missense probably damaging 1.00
R1605:Wnk2 UTSW 13 49060894 missense probably damaging 1.00
R1719:Wnk2 UTSW 13 49060726 missense possibly damaging 0.76
R1891:Wnk2 UTSW 13 49052724 nonsense probably null
R1966:Wnk2 UTSW 13 49039011 missense probably damaging 0.96
R2001:Wnk2 UTSW 13 49078682 missense possibly damaging 0.61
R2310:Wnk2 UTSW 13 49050577 missense probably damaging 0.97
R2356:Wnk2 UTSW 13 49039168 nonsense probably null
R2406:Wnk2 UTSW 13 49061488 missense possibly damaging 0.86
R2519:Wnk2 UTSW 13 49071029 missense probably damaging 0.99
R3962:Wnk2 UTSW 13 49070977 missense probably damaging 1.00
R4160:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4161:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4226:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4227:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4234:Wnk2 UTSW 13 49061128 missense probably benign 0.33
R4304:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4308:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4584:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4655:Wnk2 UTSW 13 49056883 missense probably damaging 1.00
R4715:Wnk2 UTSW 13 49147232 start codon destroyed unknown
R4887:Wnk2 UTSW 13 49071002 missense probably damaging 1.00
R4888:Wnk2 UTSW 13 49071002 missense probably damaging 1.00
R4945:Wnk2 UTSW 13 49057246 missense probably damaging 1.00
R5182:Wnk2 UTSW 13 49061161 missense possibly damaging 0.92
R5243:Wnk2 UTSW 13 49072578 missense possibly damaging 0.51
R5370:Wnk2 UTSW 13 49102961 missense probably damaging 1.00
R5771:Wnk2 UTSW 13 49102800 missense probably damaging 1.00
R5900:Wnk2 UTSW 13 49102832 missense probably damaging 1.00
R5905:Wnk2 UTSW 13 49076345 missense probably damaging 0.99
R5912:Wnk2 UTSW 13 49060774 missense probably damaging 1.00
R5915:Wnk2 UTSW 13 49078085 missense probably damaging 0.99
R6028:Wnk2 UTSW 13 49076345 missense probably damaging 0.99
R6074:Wnk2 UTSW 13 49051399 missense probably damaging 1.00
R6171:Wnk2 UTSW 13 49060832 missense probably damaging 1.00
R6368:Wnk2 UTSW 13 49061338 missense probably damaging 0.99
R6467:Wnk2 UTSW 13 49146605 missense probably damaging 1.00
R6501:Wnk2 UTSW 13 49146683 missense probably damaging 1.00
R6849:Wnk2 UTSW 13 49067358 missense probably damaging 1.00
R6898:Wnk2 UTSW 13 49071081 missense probably damaging 1.00
R6949:Wnk2 UTSW 13 49101140 missense probably damaging 1.00
R7011:Wnk2 UTSW 13 49071091 missense probably damaging 0.99
R7097:Wnk2 UTSW 13 49102838 missense possibly damaging 0.86
R7121:Wnk2 UTSW 13 49147177 missense probably benign 0.26
R7123:Wnk2 UTSW 13 49081986 missense possibly damaging 0.90
R7423:Wnk2 UTSW 13 49038132 missense probably benign 0.07
R7502:Wnk2 UTSW 13 49147244 splice site probably null
R7529:Wnk2 UTSW 13 49100981 missense possibly damaging 0.50
R7751:Wnk2 UTSW 13 49078017 missense unknown
R8118:Wnk2 UTSW 13 49090983 missense probably damaging 0.99
R8121:Wnk2 UTSW 13 49060939 nonsense probably null
R8155:Wnk2 UTSW 13 49039101 missense unknown
RF023:Wnk2 UTSW 13 49146779 missense probably benign 0.00
X0025:Wnk2 UTSW 13 49060942 missense probably damaging 0.99
X0063:Wnk2 UTSW 13 49038977 missense probably benign 0.00
Z1176:Wnk2 UTSW 13 49038061 missense unknown
Predicted Primers PCR Primer
(F):5'- GAAGTGGTAACTTGGCCTGCAG -3'
(R):5'- TAAGAGGGAGCTTGAGTCCC -3'

Sequencing Primer
(F):5'- TGACAGTATGGGTCAGCAGC -3'
(R):5'- AGCTTGAGTCCCTGCTCACAG -3'
Posted On2017-02-10