Incidental Mutation 'R5877:Atp9b'
ID455627
Institutional Source Beutler Lab
Gene Symbol Atp9b
Ensembl Gene ENSMUSG00000024566
Gene NameATPase, class II, type 9B
SynonymsIIb
MMRRC Submission 044083-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5877 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location80734141-80934058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 80752789 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 957 (V957I)
Ref Sequence ENSEMBL: ENSMUSP00000153157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091790] [ENSMUST00000225235] [ENSMUST00000225980]
Predicted Effect unknown
Transcript: ENSMUST00000091790
AA Change: V957I
SMART Domains Protein: ENSMUSP00000089394
Gene: ENSMUSG00000024566
AA Change: V957I

DomainStartEndE-ValueType
low complexity region 11 39 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 110 181 5.3e-21 PFAM
Pfam:E1-E2_ATPase 186 444 9.1e-15 PFAM
Pfam:Hydrolase 463 885 2.7e-13 PFAM
Pfam:HAD 464 882 4.8e-14 PFAM
Pfam:Cation_ATPase 563 664 3.7e-7 PFAM
Pfam:PhoLip_ATPase_C 899 1128 1.1e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224283
Predicted Effect unknown
Transcript: ENSMUST00000225092
AA Change: V13I
Predicted Effect unknown
Transcript: ENSMUST00000225218
AA Change: V32I
Predicted Effect probably benign
Transcript: ENSMUST00000225235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225692
Predicted Effect probably benign
Transcript: ENSMUST00000225980
AA Change: V957I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0752 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik G T 18: 77,643,206 probably null Het
Adam6b A T 12: 113,490,202 H213L probably damaging Het
Alk A G 17: 71,967,526 W597R probably damaging Het
Ash1l G A 3: 88,981,584 V257I probably benign Het
Birc3 A C 9: 7,849,346 C576G probably damaging Het
Brca2 T C 5: 150,543,221 M2150T possibly damaging Het
C3ar1 T G 6: 122,850,622 D212A probably benign Het
Cacna1s T C 1: 136,100,667 F914S probably damaging Het
Camk1d T C 2: 5,565,665 I62V probably benign Het
Caskin1 T C 17: 24,505,265 M1009T possibly damaging Het
Casp2 A G 6: 42,276,637 probably benign Het
Cd2bp2 T A 7: 127,194,799 Y106F probably damaging Het
Celsr3 G A 9: 108,845,727 C2763Y probably damaging Het
Cyp2g1 T G 7: 26,816,640 L310V possibly damaging Het
Dusp22 G A 13: 30,707,961 V99M probably damaging Het
Fam131b G A 6: 42,320,979 S92L probably benign Het
Fbxw10 A T 11: 62,857,716 N390Y probably damaging Het
Flg2 A T 3: 93,203,449 H928L unknown Het
Gapdhs T C 7: 30,732,347 T280A probably damaging Het
Hdac11 A G 6: 91,157,542 K50E probably damaging Het
Hif3a G T 7: 17,051,146 A181E probably damaging Het
Ikbkap A T 4: 56,787,807 W375R probably damaging Het
Itgb8 A G 12: 119,202,536 S87P probably benign Het
Klhl12 T A 1: 134,483,820 Y302* probably null Het
Lhx1 C A 11: 84,522,239 D30Y probably damaging Het
Mrpl40 A G 16: 18,872,385 Y148H probably damaging Het
Myh13 A T 11: 67,353,658 H1007L possibly damaging Het
Nhlrc2 T C 19: 56,570,584 I167T probably damaging Het
Nxpe3 A T 16: 55,866,201 I148K probably damaging Het
Odf2l A G 3: 145,129,010 probably null Het
Otud7b C T 3: 96,151,960 R347* probably null Het
P3h4 G T 11: 100,414,017 H181Q probably benign Het
P4htm T A 9: 108,583,733 Y180F possibly damaging Het
Pcna-ps2 A G 19: 9,284,099 I241V probably benign Het
Pcnx2 T C 8: 125,753,728 S1947G probably damaging Het
Piezo2 T C 18: 63,113,934 I336V probably benign Het
Plcd1 T C 9: 119,076,172 D157G probably damaging Het
Plekhm2 A C 4: 141,639,693 I212S probably damaging Het
Pmvk G T 3: 89,464,369 C57F probably benign Het
Pole T C 5: 110,332,463 S91P probably benign Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Ppp4r3b A T 11: 29,209,356 D570V probably damaging Het
Pxdn T A 12: 30,003,046 I1074N probably damaging Het
Ralgapa2 A T 2: 146,388,569 D1025E probably damaging Het
Ralgps1 A G 2: 33,243,628 probably benign Het
Rasal1 C T 5: 120,679,070 probably benign Het
Rps2 A T 17: 24,720,916 probably benign Het
Scn7a G C 2: 66,699,873 Y709* probably null Het
Skint1 T A 4: 112,021,523 C217* probably null Het
Slc50a1 T C 3: 89,269,153 Y82C probably damaging Het
Slc9a4 T C 1: 40,612,263 V567A probably benign Het
Snx27 A T 3: 94,502,963 W469R probably damaging Het
Sos2 A G 12: 69,596,795 L937P probably damaging Het
Ssh1 T C 5: 113,943,120 T728A probably benign Het
Tnfrsf8 G A 4: 145,292,687 R193C probably benign Het
Usp33 T A 3: 152,379,476 M583K possibly damaging Het
Usp33 G A 3: 152,379,596 C623Y probably damaging Het
Wdfy3 T C 5: 101,869,989 I2562V probably damaging Het
Wnk2 T C 13: 49,067,306 D1175G probably damaging Het
Zcchc11 T C 4: 108,512,923 V673A probably damaging Het
Zfp341 G A 2: 154,632,289 E338K probably damaging Het
Zfp398 A G 6: 47,840,704 probably benign Het
Zp2 T A 7: 120,133,339 K661N probably null Het
Other mutations in Atp9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Atp9b APN 18 80917888 intron probably benign
IGL00769:Atp9b APN 18 80912853 missense probably benign 0.08
IGL00851:Atp9b APN 18 80765910 missense probably damaging 1.00
IGL01529:Atp9b APN 18 80844611 intron probably benign
IGL01637:Atp9b APN 18 80756455 missense probably benign 0.06
IGL01973:Atp9b APN 18 80758303 missense probably benign 0.02
IGL02082:Atp9b APN 18 80891930 intron probably benign
IGL02560:Atp9b APN 18 80762198 missense probably benign 0.23
IGL02981:Atp9b APN 18 80754289 missense possibly damaging 0.93
IGL03151:Atp9b APN 18 80776850 missense probably benign 0.28
IGL03304:Atp9b APN 18 80917877 missense probably damaging 1.00
IGL03348:Atp9b APN 18 80836422 missense possibly damaging 0.88
R0056:Atp9b UTSW 18 80765803 missense probably damaging 0.99
R0355:Atp9b UTSW 18 80909585 intron probably benign
R0366:Atp9b UTSW 18 80762102 missense probably damaging 1.00
R0557:Atp9b UTSW 18 80765922 missense probably damaging 1.00
R0612:Atp9b UTSW 18 80753956 missense possibly damaging 0.81
R1099:Atp9b UTSW 18 80858626 missense probably damaging 1.00
R1126:Atp9b UTSW 18 80778954 missense probably damaging 1.00
R1499:Atp9b UTSW 18 80762138 missense probably damaging 0.99
R1499:Atp9b UTSW 18 80778907 missense probably benign 0.02
R1764:Atp9b UTSW 18 80909591 critical splice donor site probably null
R1780:Atp9b UTSW 18 80776897 nonsense probably null
R1782:Atp9b UTSW 18 80765922 missense probably damaging 1.00
R1835:Atp9b UTSW 18 80778883 missense probably benign 0.00
R1859:Atp9b UTSW 18 80749920 missense possibly damaging 0.95
R1953:Atp9b UTSW 18 80754307 missense possibly damaging 0.80
R2140:Atp9b UTSW 18 80736087 missense probably damaging 0.99
R2191:Atp9b UTSW 18 80753051 missense probably damaging 1.00
R4118:Atp9b UTSW 18 80749829 missense possibly damaging 0.83
R4605:Atp9b UTSW 18 80753149 critical splice acceptor site probably null
R4654:Atp9b UTSW 18 80891878 missense probably benign 0.00
R4767:Atp9b UTSW 18 80753070 missense probably damaging 1.00
R4775:Atp9b UTSW 18 80765769 critical splice donor site probably null
R4936:Atp9b UTSW 18 80736093 missense possibly damaging 0.58
R5096:Atp9b UTSW 18 80762184 missense probably benign 0.39
R5279:Atp9b UTSW 18 80912858 missense probably damaging 0.98
R5394:Atp9b UTSW 18 80776837 missense probably benign 0.16
R5774:Atp9b UTSW 18 80933932 missense probably damaging 0.96
R6080:Atp9b UTSW 18 80738808 missense probably benign 0.03
R6170:Atp9b UTSW 18 80877347 missense probably benign 0.16
R6250:Atp9b UTSW 18 80756521 missense probably benign 0.01
R6340:Atp9b UTSW 18 80778900 missense probably benign 0.38
R6498:Atp9b UTSW 18 80777015 missense probably benign 0.03
R6620:Atp9b UTSW 18 80808687 nonsense probably null
R6632:Atp9b UTSW 18 80808649 missense probably damaging 1.00
R6665:Atp9b UTSW 18 80917735 missense probably benign 0.26
R6821:Atp9b UTSW 18 80847248 missense probably damaging 1.00
R6927:Atp9b UTSW 18 80891857 missense possibly damaging 0.63
R6977:Atp9b UTSW 18 80753102 missense probably damaging 1.00
R7133:Atp9b UTSW 18 80909656 missense
R7188:Atp9b UTSW 18 80917826 missense
R7396:Atp9b UTSW 18 80736842 missense
R7432:Atp9b UTSW 18 80765841 missense
R7457:Atp9b UTSW 18 80917618 intron probably null
R7877:Atp9b UTSW 18 80847197 missense
R7960:Atp9b UTSW 18 80847197 missense
R8072:Atp9b UTSW 18 80765061 missense
Z1176:Atp9b UTSW 18 80765865 missense
Predicted Primers PCR Primer
(F):5'- AAGGCATATGCGTACAGGTG -3'
(R):5'- GGTATCAATGCCCACCATGC -3'

Sequencing Primer
(F):5'- CATATGCGTACAGGTGTTTTTCAAG -3'
(R):5'- TCAGCAGGCAGTGGCTTCTC -3'
Posted On2017-02-10