Incidental Mutation 'R5878:Mgst2'
ID455641
Institutional Source Beutler Lab
Gene Symbol Mgst2
Ensembl Gene ENSMUSG00000074604
Gene Namemicrosomal glutathione S-transferase 2
SynonymsMGST-II, GST2
MMRRC Submission 044084-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R5878 (G1)
Quality Score202
Status Validated
Chromosome3
Chromosomal Location51660360-51682677 bp(+) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) A to T at 51661230 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099106] [ENSMUST00000159554] [ENSMUST00000161590]
Predicted Effect probably benign
Transcript: ENSMUST00000099106
SMART Domains Protein: ENSMUSP00000096705
Gene: ENSMUSG00000074604

DomainStartEndE-ValueType
Pfam:MAPEG 8 124 8.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159554
SMART Domains Protein: ENSMUSP00000141745
Gene: ENSMUSG00000074604

DomainStartEndE-ValueType
Pfam:MAPEG 8 80 3.8e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160753
Predicted Effect probably benign
Transcript: ENSMUST00000161590
SMART Domains Protein: ENSMUSP00000125670
Gene: ENSMUSG00000074604

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161627
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The MAPEG (Membrane Associated Proteins in Eicosanoid and Glutathione metabolism) family consists of six human proteins, several of which are involved in the production of leukotrienes and prostaglandin E, important mediators of inflammation. This gene encodes a protein which catalyzes the conjugation of leukotriene A4 and reduced glutathione to produce leukotriene C4. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trap allele display resistance to induced ER stress related cell death and mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,692,960 S387T probably benign Het
Abca12 A T 1: 71,346,633 N275K possibly damaging Het
Abhd6 G A 14: 8,028,286 V6I probably benign Het
Afap1l2 T C 19: 56,915,675 T727A probably benign Het
Aggf1 T C 13: 95,369,557 E174G probably benign Het
Ahnak T G 19: 9,008,342 L2330R probably damaging Het
Arfgef2 A G 2: 166,870,217 T1205A probably benign Het
Ccdc3 T C 2: 5,229,016 L217P probably benign Het
Cfap54 T C 10: 92,964,561 D1595G probably benign Het
Cps1 G T 1: 67,157,878 probably null Het
Fam120b A G 17: 15,402,240 D160G probably damaging Het
Fam172a T A 13: 77,952,067 V129E probably damaging Het
Fezf1 C A 6: 23,247,581 R165L possibly damaging Het
Fkbp15 A T 4: 62,306,908 L838H probably benign Het
Frmd3 G A 4: 74,153,610 G243D probably damaging Het
Gldc A T 19: 30,143,467 probably null Het
Gm10188 T C 1: 132,229,202 probably benign Het
Gm5190 T A 12: 113,397,239 noncoding transcript Het
Gria1 T C 11: 57,317,802 probably null Het
Hdhd5 A G 6: 120,514,524 L206P probably damaging Het
Herc2 A G 7: 56,124,248 N1149S probably benign Het
Inca1 G A 11: 70,695,982 probably benign Het
Iqch G A 9: 63,547,990 S175F probably damaging Het
Itpr3 T G 17: 27,110,862 D1543E probably benign Het
Khk T A 5: 30,930,875 probably null Het
Kiz C T 2: 146,889,601 S337L probably damaging Het
Lzts3 G A 2: 130,636,539 T213I probably damaging Het
Mab21l2 T A 3: 86,546,718 D325V probably damaging Het
Mctp2 A G 7: 72,214,108 S336P probably benign Het
Me3 T A 7: 89,848,006 L405Q probably benign Het
Myh2 A G 11: 67,192,504 E1431G probably damaging Het
Naip6 A G 13: 100,299,673 S781P probably damaging Het
Nr3c2 A G 8: 76,908,268 probably null Het
Olfr509 A T 7: 108,645,739 L279Q probably damaging Het
Olfr750 A G 14: 51,070,992 Y134H probably damaging Het
Olfr986 C T 9: 40,187,571 T152I probably benign Het
Otop1 G T 5: 38,277,822 R132L possibly damaging Het
Parg T A 14: 32,217,662 D548E possibly damaging Het
Pcdhga4 G T 18: 37,687,686 G763W probably benign Het
Pde10a A G 17: 8,949,372 N9S possibly damaging Het
Pi4k2a T C 19: 42,100,641 I147T probably benign Het
Polh T A 17: 46,194,325 T122S probably damaging Het
Ptpn13 T C 5: 103,477,118 V96A possibly damaging Het
Ptpn6 C A 6: 124,728,785 C132F probably damaging Het
Rbm19 T A 5: 120,132,867 V585E probably damaging Het
Rp1l1 C T 14: 64,028,906 P647L probably benign Het
Rrp1b A G 17: 32,047,675 E72G probably damaging Het
Shcbp1 A T 8: 4,748,742 H392Q probably benign Het
Skiv2l C T 17: 34,846,117 R371Q possibly damaging Het
Slc13a5 G A 11: 72,253,391 T287I possibly damaging Het
Slc22a27 T A 19: 7,926,757 E5V probably benign Het
Slc38a2 A G 15: 96,692,584 V293A probably damaging Het
Slco6d1 T A 1: 98,463,836 probably benign Het
Sri G C 5: 8,059,353 D46H probably damaging Het
Tango6 A G 8: 106,689,168 D207G possibly damaging Het
Tigd4 T C 3: 84,594,442 M222T probably benign Het
Tmem229a T C 6: 24,955,173 D194G probably benign Het
Trank1 T C 9: 111,366,685 V1259A possibly damaging Het
Trdv5 T C 14: 54,148,798 D70G probably benign Het
Trim52 T A 14: 106,106,941 M11K probably damaging Het
Wdr62 A G 7: 30,241,347 M882T probably benign Het
Ybx3 A G 6: 131,367,763 probably null Het
Zfand2b A G 1: 75,170,510 probably benign Het
Zfp91 T A 19: 12,770,320 T480S possibly damaging Het
Other mutations in Mgst2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00824:Mgst2 APN 3 51682578 missense probably benign 0.00
IGL01712:Mgst2 APN 3 51664571 missense probably damaging 1.00
IGL03401:Mgst2 APN 3 51664512 missense possibly damaging 0.89
R0294:Mgst2 UTSW 3 51681830 missense probably damaging 1.00
R2867:Mgst2 UTSW 3 51664533 synonymous silent
R4394:Mgst2 UTSW 3 51664528 missense probably damaging 1.00
R5149:Mgst2 UTSW 3 51682537 missense probably benign 0.02
R6703:Mgst2 UTSW 3 51664612 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGTTTTCTCTTCCAGTGCAAAG -3'
(R):5'- CACTCTGAGCAACTGTCTGC -3'

Sequencing Primer
(F):5'- CCAGTGCAAAGGTTGTTACTC -3'
(R):5'- AACTGTCTGCTGGGCAC -3'
Posted On2017-02-10