Incidental Mutation 'R5878:Frmd3'
ID455645
Institutional Source Beutler Lab
Gene Symbol Frmd3
Ensembl Gene ENSMUSG00000049122
Gene NameFERM domain containing 3
Synonyms4.1O, EPB41L4O, P410, 9430066I12Rik
MMRRC Submission 044084-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock #R5878 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location74013442-74202214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 74153610 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 243 (G243D)
Ref Sequence ENSEMBL: ENSMUSP00000095615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084474] [ENSMUST00000098006]
Predicted Effect probably damaging
Transcript: ENSMUST00000084474
AA Change: G243D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081514
Gene: ENSMUSG00000049122
AA Change: G243D

DomainStartEndE-ValueType
B41 28 225 5.17e-57 SMART
FERM_C 229 316 1.93e-18 SMART
FA 322 368 4.1e-13 SMART
low complexity region 391 401 N/A INTRINSIC
transmembrane domain 530 552 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098006
AA Change: G243D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095615
Gene: ENSMUSG00000049122
AA Change: G243D

DomainStartEndE-ValueType
B41 28 225 5.17e-57 SMART
FERM_C 229 316 1.93e-18 SMART
FA 322 368 4.1e-13 SMART
low complexity region 391 401 N/A INTRINSIC
transmembrane domain 529 551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single pass membrane protein primarily found in ovaries. A similar protein in erythrocytes helps determine the shape of red blood cells, but the function of the encoded protein has not been determined. There is some evidence that this is a tumor suppressor gene, and there is also evidence linking defects in this gene to susceptibility to diabetic nephropathy in type 1 diabetes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,692,960 S387T probably benign Het
Abca12 A T 1: 71,346,633 N275K possibly damaging Het
Abhd6 G A 14: 8,028,286 V6I probably benign Het
Afap1l2 T C 19: 56,915,675 T727A probably benign Het
Aggf1 T C 13: 95,369,557 E174G probably benign Het
Ahnak T G 19: 9,008,342 L2330R probably damaging Het
Arfgef2 A G 2: 166,870,217 T1205A probably benign Het
Ccdc3 T C 2: 5,229,016 L217P probably benign Het
Cfap54 T C 10: 92,964,561 D1595G probably benign Het
Cps1 G T 1: 67,157,878 probably null Het
Fam120b A G 17: 15,402,240 D160G probably damaging Het
Fam172a T A 13: 77,952,067 V129E probably damaging Het
Fezf1 C A 6: 23,247,581 R165L possibly damaging Het
Fkbp15 A T 4: 62,306,908 L838H probably benign Het
Gldc A T 19: 30,143,467 probably null Het
Gm10188 T C 1: 132,229,202 probably benign Het
Gm5190 T A 12: 113,397,239 noncoding transcript Het
Gria1 T C 11: 57,317,802 probably null Het
Hdhd5 A G 6: 120,514,524 L206P probably damaging Het
Herc2 A G 7: 56,124,248 N1149S probably benign Het
Inca1 G A 11: 70,695,982 probably benign Het
Iqch G A 9: 63,547,990 S175F probably damaging Het
Itpr3 T G 17: 27,110,862 D1543E probably benign Het
Khk T A 5: 30,930,875 probably null Het
Kiz C T 2: 146,889,601 S337L probably damaging Het
Lzts3 G A 2: 130,636,539 T213I probably damaging Het
Mab21l2 T A 3: 86,546,718 D325V probably damaging Het
Mctp2 A G 7: 72,214,108 S336P probably benign Het
Me3 T A 7: 89,848,006 L405Q probably benign Het
Mgst2 A T 3: 51,661,230 probably benign Het
Myh2 A G 11: 67,192,504 E1431G probably damaging Het
Naip6 A G 13: 100,299,673 S781P probably damaging Het
Nr3c2 A G 8: 76,908,268 probably null Het
Olfr509 A T 7: 108,645,739 L279Q probably damaging Het
Olfr750 A G 14: 51,070,992 Y134H probably damaging Het
Olfr986 C T 9: 40,187,571 T152I probably benign Het
Otop1 G T 5: 38,277,822 R132L possibly damaging Het
Parg T A 14: 32,217,662 D548E possibly damaging Het
Pcdhga4 G T 18: 37,687,686 G763W probably benign Het
Pde10a A G 17: 8,949,372 N9S possibly damaging Het
Pi4k2a T C 19: 42,100,641 I147T probably benign Het
Polh T A 17: 46,194,325 T122S probably damaging Het
Ptpn13 T C 5: 103,477,118 V96A possibly damaging Het
Ptpn6 C A 6: 124,728,785 C132F probably damaging Het
Rbm19 T A 5: 120,132,867 V585E probably damaging Het
Rp1l1 C T 14: 64,028,906 P647L probably benign Het
Rrp1b A G 17: 32,047,675 E72G probably damaging Het
Shcbp1 A T 8: 4,748,742 H392Q probably benign Het
Skiv2l C T 17: 34,846,117 R371Q possibly damaging Het
Slc13a5 G A 11: 72,253,391 T287I possibly damaging Het
Slc22a27 T A 19: 7,926,757 E5V probably benign Het
Slc38a2 A G 15: 96,692,584 V293A probably damaging Het
Slco6d1 T A 1: 98,463,836 probably benign Het
Sri G C 5: 8,059,353 D46H probably damaging Het
Tango6 A G 8: 106,689,168 D207G possibly damaging Het
Tigd4 T C 3: 84,594,442 M222T probably benign Het
Tmem229a T C 6: 24,955,173 D194G probably benign Het
Trank1 T C 9: 111,366,685 V1259A possibly damaging Het
Trdv5 T C 14: 54,148,798 D70G probably benign Het
Trim52 T A 14: 106,106,941 M11K probably damaging Het
Wdr62 A G 7: 30,241,347 M882T probably benign Het
Ybx3 A G 6: 131,367,763 probably null Het
Zfand2b A G 1: 75,170,510 probably benign Het
Zfp91 T A 19: 12,770,320 T480S possibly damaging Het
Other mutations in Frmd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Frmd3 APN 4 74074120 missense possibly damaging 0.62
IGL01774:Frmd3 APN 4 74187838 missense probably damaging 1.00
IGL02213:Frmd3 APN 4 74135872 missense probably benign 0.36
IGL02479:Frmd3 APN 4 74187515 missense probably benign 0.30
IGL03248:Frmd3 APN 4 74128218 missense possibly damaging 0.71
R0765:Frmd3 UTSW 4 74161767 missense probably damaging 1.00
R1411:Frmd3 UTSW 4 74153621 missense probably damaging 1.00
R1535:Frmd3 UTSW 4 74013758 start gained probably benign
R1990:Frmd3 UTSW 4 74187439 missense probably damaging 1.00
R3898:Frmd3 UTSW 4 74074109 missense probably damaging 1.00
R4377:Frmd3 UTSW 4 74128298 critical splice donor site probably null
R4616:Frmd3 UTSW 4 74187872 missense probably benign 0.15
R4965:Frmd3 UTSW 4 74153600 missense probably damaging 1.00
R5024:Frmd3 UTSW 4 74098144 missense probably benign 0.00
R5104:Frmd3 UTSW 4 74145078 missense probably damaging 1.00
R5418:Frmd3 UTSW 4 74161698 critical splice acceptor site probably null
R5434:Frmd3 UTSW 4 74187796 missense probably damaging 1.00
R5999:Frmd3 UTSW 4 74170691 missense possibly damaging 0.49
R6031:Frmd3 UTSW 4 74187451 missense probably damaging 0.99
R6031:Frmd3 UTSW 4 74187451 missense probably damaging 0.99
R6616:Frmd3 UTSW 4 74187488 missense probably damaging 0.97
R6813:Frmd3 UTSW 4 74159245 missense probably benign 0.00
R6941:Frmd3 UTSW 4 74098126 missense probably benign 0.20
R7233:Frmd3 UTSW 4 74013786 missense probably benign 0.09
R7334:Frmd3 UTSW 4 74161718 missense probably benign 0.02
R7429:Frmd3 UTSW 4 74145105 missense probably damaging 0.98
R7430:Frmd3 UTSW 4 74145105 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AACAATAGGTAACCCCAGATTTTGTCC -3'
(R):5'- AAGTTGACAGTTAAAGCTAACTACC -3'

Sequencing Primer
(F):5'- CCCCAGATTTTGTCCAGAATTTAG -3'
(R):5'- GAAGGATGCACTTACCATT -3'
Posted On2017-02-10