Mutagenetix > Incidental Mutations

Incidental Mutation 'R5878:Ptpn13'

455647

Institutional Source

Beutler Lab

Gene Symbol

Ptpn13

Ensembl Gene

ENSMUSG00000034573

Gene Name

protein tyrosine phosphatase, non-receptor type 13

Synonyms

PTPL1, Ptpri, PTP-BL

MMRRC Submission

044084-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.283) question?

Stock #

R5878 (G1)

Quality Score

224

Status

Validated

Chromosome

Chromosomal Location

103425192-103598303 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 103477118 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 96 (V96A)

Ref Sequence

ENSEMBL: ENSMUSP00000048119 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048957] [ENSMUST00000196014]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000048957
AA Change: V96A

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000048119
Gene: ENSMUSG00000034573
AA Change: V96A

Domain	Start	End	E-Value	Type
KIND	3	190	2.3e-80	SMART
Blast:B41	340	447	6e-34	BLAST
coiled coil region	460	487	N/A	INTRINSIC
B41	561	774	3.3e-68	SMART
FERM_C	780	869	3.2e-35	SMART
low complexity region	1049	1058	N/A	INTRINSIC
PDZ	1093	1170	7.6e-25	SMART
low complexity region	1224	1236	N/A	INTRINSIC
low complexity region	1309	1322	N/A	INTRINSIC
low complexity region	1331	1341	N/A	INTRINSIC
PDZ	1365	1442	1.7e-24	SMART
low complexity region	1450	1468	N/A	INTRINSIC
PDZ	1499	1579	3.5e-19	SMART
PDZ	1773	1845	1.2e-21	SMART
PDZ	1867	1942	1.6e-16	SMART
low complexity region	2123	2134	N/A	INTRINSIC
PTPc	2179	2436	6.9e-113	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000196014
AA Change: V96A

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000143571
Gene: ENSMUSG00000034573
AA Change: V96A

Domain	Start	End	E-Value	Type
KIND	3	190	2.3e-80	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196800

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199412

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.7%

Validation Efficiency

99% (66/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP is a large intracellular protein. It has a catalytic PTP domain at its C-terminus and two major structural domains: a region with five PDZ domains and a FERM domain that binds to plasma membrane and cytoskeletal elements. This PTP was found to interact with, and dephosphorylate, Fas receptor and IkappaBalpha through the PDZ domains. This suggests it has a role in Fas mediated programmed cell death. This PTP was also shown to interact with GTPase-activating protein, and thus may function as a regulator of Rho signaling pathways. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal T-helper cell differentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,692,960	S387T	probably benign	Het
Abca12	A	T	1: 71,346,633	N275K	possibly damaging	Het
Abhd6	G	A	14: 8,028,286	V6I	probably benign	Het
Afap1l2	T	C	19: 56,915,675	T727A	probably benign	Het
Aggf1	T	C	13: 95,369,557	E174G	probably benign	Het
Ahnak	T	G	19: 9,008,342	L2330R	probably damaging	Het
Arfgef2	A	G	2: 166,870,217	T1205A	probably benign	Het
Ccdc3	T	C	2: 5,229,016	L217P	probably benign	Het
Cfap54	T	C	10: 92,964,561	D1595G	probably benign	Het
Cps1	G	T	1: 67,157,878		probably null	Het
Fam120b	A	G	17: 15,402,240	D160G	probably damaging	Het
Fam172a	T	A	13: 77,952,067	V129E	probably damaging	Het
Fezf1	C	A	6: 23,247,581	R165L	possibly damaging	Het
Fkbp15	A	T	4: 62,306,908	L838H	probably benign	Het
Frmd3	G	A	4: 74,153,610	G243D	probably damaging	Het
Gldc	A	T	19: 30,143,467		probably null	Het
Gm10188	T	C	1: 132,229,202		probably benign	Het
Gm5190	T	A	12: 113,397,239		noncoding transcript	Het
Gria1	T	C	11: 57,317,802		probably null	Het
Hdhd5	A	G	6: 120,514,524	L206P	probably damaging	Het
Herc2	A	G	7: 56,124,248	N1149S	probably benign	Het
Inca1	G	A	11: 70,695,982		probably benign	Het
Iqch	G	A	9: 63,547,990	S175F	probably damaging	Het
Itpr3	T	G	17: 27,110,862	D1543E	probably benign	Het
Khk	T	A	5: 30,930,875		probably null	Het
Kiz	C	T	2: 146,889,601	S337L	probably damaging	Het
Lzts3	G	A	2: 130,636,539	T213I	probably damaging	Het
Mab21l2	T	A	3: 86,546,718	D325V	probably damaging	Het
Mctp2	A	G	7: 72,214,108	S336P	probably benign	Het
Me3	T	A	7: 89,848,006	L405Q	probably benign	Het
Mgst2	A	T	3: 51,661,230		probably benign	Het
Myh2	A	G	11: 67,192,504	E1431G	probably damaging	Het
Naip6	A	G	13: 100,299,673	S781P	probably damaging	Het
Nr3c2	A	G	8: 76,908,268		probably null	Het
Olfr509	A	T	7: 108,645,739	L279Q	probably damaging	Het
Olfr750	A	G	14: 51,070,992	Y134H	probably damaging	Het
Olfr986	C	T	9: 40,187,571	T152I	probably benign	Het
Otop1	G	T	5: 38,277,822	R132L	possibly damaging	Het
Parg	T	A	14: 32,217,662	D548E	possibly damaging	Het
Pcdhga4	G	T	18: 37,687,686	G763W	probably benign	Het
Pde10a	A	G	17: 8,949,372	N9S	possibly damaging	Het
Pi4k2a	T	C	19: 42,100,641	I147T	probably benign	Het
Polh	T	A	17: 46,194,325	T122S	probably damaging	Het
Ptpn6	C	A	6: 124,728,785	C132F	probably damaging	Het
Rbm19	T	A	5: 120,132,867	V585E	probably damaging	Het
Rp1l1	C	T	14: 64,028,906	P647L	probably benign	Het
Rrp1b	A	G	17: 32,047,675	E72G	probably damaging	Het
Shcbp1	A	T	8: 4,748,742	H392Q	probably benign	Het
Skiv2l	C	T	17: 34,846,117	R371Q	possibly damaging	Het
Slc13a5	G	A	11: 72,253,391	T287I	possibly damaging	Het
Slc22a27	T	A	19: 7,926,757	E5V	probably benign	Het
Slc38a2	A	G	15: 96,692,584	V293A	probably damaging	Het
Slco6d1	T	A	1: 98,463,836		probably benign	Het
Sri	G	C	5: 8,059,353	D46H	probably damaging	Het
Tango6	A	G	8: 106,689,168	D207G	possibly damaging	Het
Tigd4	T	C	3: 84,594,442	M222T	probably benign	Het
Tmem229a	T	C	6: 24,955,173	D194G	probably benign	Het
Trank1	T	C	9: 111,366,685	V1259A	possibly damaging	Het
Trdv5	T	C	14: 54,148,798	D70G	probably benign	Het
Trim52	T	A	14: 106,106,941	M11K	probably damaging	Het
Wdr62	A	G	7: 30,241,347	M882T	probably benign	Het
Ybx3	A	G	6: 131,367,763		probably null	Het
Zfand2b	A	G	1: 75,170,510		probably benign	Het
Zfp91	T	A	19: 12,770,320	T480S	possibly damaging	Het

Other mutations in Ptpn13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Ptpn13	APN	5	103551058	missense	probably damaging	1.00
IGL00569:Ptpn13	APN	5	103591006	splice site	probably benign
IGL00764:Ptpn13	APN	5	103597718	missense	probably damaging	1.00
IGL00805:Ptpn13	APN	5	103554729	missense	probably benign	0.33
IGL00922:Ptpn13	APN	5	103588088	missense	probably damaging	1.00
IGL00959:Ptpn13	APN	5	103517571	critical splice donor site	probably null
IGL01090:Ptpn13	APN	5	103541314	missense	probably null	0.80
IGL01352:Ptpn13	APN	5	103486775	splice site	probably null
IGL01510:Ptpn13	APN	5	103562300	missense	probably damaging	1.00
IGL01515:Ptpn13	APN	5	103556113	missense	probably benign	0.06
IGL01896:Ptpn13	APN	5	103501523	missense	possibly damaging	0.78
IGL02094:Ptpn13	APN	5	103594617	missense	probably damaging	1.00
IGL02561:Ptpn13	APN	5	103562291	missense	probably damaging	1.00
IGL02562:Ptpn13	APN	5	103562291	missense	probably damaging	1.00
IGL02567:Ptpn13	APN	5	103562291	missense	probably damaging	1.00
IGL02604:Ptpn13	APN	5	103501903	missense	probably benign	0.01
IGL02679:Ptpn13	APN	5	103569454	missense	possibly damaging	0.55
IGL02981:Ptpn13	APN	5	103528804	missense	probably damaging	1.00
IGL03131:Ptpn13	APN	5	103517559	missense	probably benign
IGL03136:Ptpn13	APN	5	103543463	missense	possibly damaging	0.49
IGL03163:Ptpn13	APN	5	103591346	missense	probably damaging	1.00
IGL03271:Ptpn13	APN	5	103462148	missense	probably damaging	1.00
IGL03297:Ptpn13	APN	5	103541077	missense	probably benign	0.13
IGL03328:Ptpn13	APN	5	103516348	missense	probably benign	0.00
IGL03343:Ptpn13	APN	5	103554950	missense	possibly damaging	0.88
IGL02835:Ptpn13	UTSW	5	103560025	missense	probably damaging	0.98
P0021:Ptpn13	UTSW	5	103528820	missense	probably benign	0.39
R0017:Ptpn13	UTSW	5	103486772	critical splice donor site	probably null
R0090:Ptpn13	UTSW	5	103569503	missense	probably damaging	1.00
R0111:Ptpn13	UTSW	5	103580763	splice site	probably benign
R0183:Ptpn13	UTSW	5	103516408	missense	probably benign	0.00
R0230:Ptpn13	UTSW	5	103527131	missense	probably damaging	1.00
R0302:Ptpn13	UTSW	5	103565225	missense	probably benign
R0360:Ptpn13	UTSW	5	103533348	missense	probably damaging	1.00
R0364:Ptpn13	UTSW	5	103533348	missense	probably damaging	1.00
R0388:Ptpn13	UTSW	5	103555062	missense	probably benign	0.31
R0504:Ptpn13	UTSW	5	103501496	missense	possibly damaging	0.92
R0558:Ptpn13	UTSW	5	103529717	missense	probably damaging	0.99
R0562:Ptpn13	UTSW	5	103516425	critical splice donor site	probably null
R0568:Ptpn13	UTSW	5	103489765	missense	probably damaging	1.00
R0609:Ptpn13	UTSW	5	103556145	missense	probably benign
R0669:Ptpn13	UTSW	5	103556109	missense	probably benign
R0739:Ptpn13	UTSW	5	103575132	missense	probably benign
R1006:Ptpn13	UTSW	5	103586789	missense	probably benign	0.04
R1164:Ptpn13	UTSW	5	103489773	missense	probably damaging	1.00
R1274:Ptpn13	UTSW	5	103550260	missense	probably damaging	0.98
R1501:Ptpn13	UTSW	5	103516364	missense	probably benign	0.01
R1529:Ptpn13	UTSW	5	103564132	missense	probably benign	0.00
R1533:Ptpn13	UTSW	5	103556178	nonsense	probably null
R1613:Ptpn13	UTSW	5	103536871	missense	possibly damaging	0.89
R1616:Ptpn13	UTSW	5	103565237	missense	possibly damaging	0.49
R1830:Ptpn13	UTSW	5	103543459	missense	probably benign	0.00
R1892:Ptpn13	UTSW	5	103501679	missense	possibly damaging	0.92
R1907:Ptpn13	UTSW	5	103580709	missense	probably null	0.45
R2143:Ptpn13	UTSW	5	103556133	missense	probably benign
R2145:Ptpn13	UTSW	5	103556133	missense	probably benign
R2151:Ptpn13	UTSW	5	103525785	missense	probably damaging	1.00
R2180:Ptpn13	UTSW	5	103569558	missense	probably damaging	1.00
R2264:Ptpn13	UTSW	5	103489661	missense	possibly damaging	0.96
R2313:Ptpn13	UTSW	5	103564161	missense	probably damaging	1.00
R3522:Ptpn13	UTSW	5	103589854	splice site	probably benign
R3773:Ptpn13	UTSW	5	103477121	missense	probably damaging	1.00
R3924:Ptpn13	UTSW	5	103550741	splice site	probably benign
R4289:Ptpn13	UTSW	5	103533285	missense	probably damaging	1.00
R4348:Ptpn13	UTSW	5	103569726	missense	probably damaging	1.00
R4385:Ptpn13	UTSW	5	103533407	splice site	probably null
R4526:Ptpn13	UTSW	5	103501469	missense	probably benign	0.32
R4557:Ptpn13	UTSW	5	103541110	missense	probably damaging	1.00
R4596:Ptpn13	UTSW	5	103523692	missense	probably benign	0.06
R4632:Ptpn13	UTSW	5	103569860	missense	possibly damaging	0.46
R4727:Ptpn13	UTSW	5	103569855	missense	probably benign
R4780:Ptpn13	UTSW	5	103586773	missense	probably benign	0.04
R4793:Ptpn13	UTSW	5	103582778	critical splice donor site	probably null
R4812:Ptpn13	UTSW	5	103523615	missense	probably benign	0.00
R4939:Ptpn13	UTSW	5	103517469	intron	probably null
R4951:Ptpn13	UTSW	5	103588046	missense	probably benign	0.00
R5052:Ptpn13	UTSW	5	103561980	missense	probably damaging	1.00
R5148:Ptpn13	UTSW	5	103492232	missense	probably damaging	1.00
R5309:Ptpn13	UTSW	5	103541053	missense	probably damaging	1.00
R5521:Ptpn13	UTSW	5	103501428	missense	probably benign	0.03
R5545:Ptpn13	UTSW	5	103561964	missense	probably damaging	1.00
R5696:Ptpn13	UTSW	5	103554759	missense	probably benign	0.20
R5735:Ptpn13	UTSW	5	103554820	missense	probably benign	0.03
R5815:Ptpn13	UTSW	5	103597690	splice site	probably null
R5876:Ptpn13	UTSW	5	103476960	missense	probably damaging	1.00
R6366:Ptpn13	UTSW	5	103551053	missense	probably damaging	1.00
R6455:Ptpn13	UTSW	5	103541284	missense	probably benign	0.00
R6492:Ptpn13	UTSW	5	103501612	missense	probably benign	0.02
R6709:Ptpn13	UTSW	5	103586756	missense	probably benign	0.18
R6759:Ptpn13	UTSW	5	103565255	missense	possibly damaging	0.49
R6944:Ptpn13	UTSW	5	103476991	missense	probably null	1.00
R7079:Ptpn13	UTSW	5	103501886	missense	probably benign	0.00
R7253:Ptpn13	UTSW	5	103565284	missense	possibly damaging	0.68
R7254:Ptpn13	UTSW	5	103594636	missense	probably damaging	1.00
R7391:Ptpn13	UTSW	5	103540981	missense	probably damaging	1.00
R7451:Ptpn13	UTSW	5	103527095	missense	probably benign	0.16
R7614:Ptpn13	UTSW	5	103501465	missense	probably benign	0.13
R7652:Ptpn13	UTSW	5	103529712	missense	probably benign	0.12
R7655:Ptpn13	UTSW	5	103540983	missense	probably benign	0.00
R7656:Ptpn13	UTSW	5	103540983	missense	probably benign	0.00
R7683:Ptpn13	UTSW	5	103565152	missense	probably benign	0.01
R7734:Ptpn13	UTSW	5	103561962	missense	probably damaging	1.00
R7794:Ptpn13	UTSW	5	103492224	missense	probably benign	0.06
R7834:Ptpn13	UTSW	5	103462148	missense	probably damaging	1.00
R7911:Ptpn13	UTSW	5	103541058	missense	probably damaging	1.00
R7917:Ptpn13	UTSW	5	103462148	missense	probably damaging	1.00
R7992:Ptpn13	UTSW	5	103541058	missense	probably damaging	1.00
RF017:Ptpn13	UTSW	5	103593580	missense	probably benign	0.45

Predicted Primers

PCR Primer
(F):5'- CAACCAGTGAGCATTGCTG -3'
(R):5'- TCCTAGGTCAATATGTTTTCCTGG -3'

Sequencing Primer
(F):5'- TGAGCATTGCTGACCCTG -3'
(R):5'- GCTGAATTCCGATAAAATCTTCAAAC -3'

Posted On

2017-02-10