Mutagenetix > Incidental Mutations

Incidental Mutation 'R5878:Gria1'

455665

Institutional Source

Beutler Lab

Gene Symbol

Gria1

Ensembl Gene

ENSMUSG00000020524

Gene Name

glutamate receptor, ionotropic, AMPA1 (alpha 1)

Synonyms

Glr1, Glur-1, GluRA, HIPA1, GluR1, GluR-A, 2900051M01Rik, Glur1, GluA1, Glr-1

MMRRC Submission

044084-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5878 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57011387-57330244 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 57317802 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000117746 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036315] [ENSMUST00000094179] [ENSMUST00000151045]

Predicted Effect

probably null
Transcript: ENSMUST00000036315

SMART Domains

Protein: ENSMUSP00000044494
Gene: ENSMUSG00000020524

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	37	372	9.3e-63	PFAM
PBPe	408	783	3.65e-121	SMART
Lig_chan-Glu_bd	418	483	1.65e-29	SMART
low complexity region	863	874	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000094179

SMART Domains

Protein: ENSMUSP00000091731
Gene: ENSMUSG00000020524

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	37	372	3.7e-69	PFAM
PBPe	408	783	2.09e-121	SMART
Lig_chan-Glu_bd	418	483	1.65e-29	SMART
low complexity region	863	874	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000151045

SMART Domains

Protein: ENSMUSP00000117746
Gene: ENSMUSG00000020524

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	1	303	4.7e-58	PFAM
PBPe	339	714	3.65e-121	SMART
Lig_chan-Glu_bd	349	414	1.65e-29	SMART
transmembrane domain	739	761	N/A	INTRINSIC
low complexity region	794	805	N/A	INTRINSIC

Meta Mutation Damage Score

0.9496

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.7%

Validation Efficiency

99% (66/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes with multiple subunits, each possessing transmembrane regions, and all arranged to form a ligand-gated ion channel. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. This gene belongs to a family of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) receptors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice with mutations in phosphorylation sites have LTD and LTP deficits and spatial learning memory defects. Null homozygotes also show stimulus-reward learning deficits and increases locomotor activity and context-dependent sensitization to amphetamine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,692,960	S387T	probably benign	Het
Abca12	A	T	1: 71,346,633	N275K	possibly damaging	Het
Abhd6	G	A	14: 8,028,286	V6I	probably benign	Het
Afap1l2	T	C	19: 56,915,675	T727A	probably benign	Het
Aggf1	T	C	13: 95,369,557	E174G	probably benign	Het
Ahnak	T	G	19: 9,008,342	L2330R	probably damaging	Het
Arfgef2	A	G	2: 166,870,217	T1205A	probably benign	Het
Ccdc3	T	C	2: 5,229,016	L217P	probably benign	Het
Cfap54	T	C	10: 92,964,561	D1595G	probably benign	Het
Cps1	G	T	1: 67,157,878		probably null	Het
Fam120b	A	G	17: 15,402,240	D160G	probably damaging	Het
Fam172a	T	A	13: 77,952,067	V129E	probably damaging	Het
Fezf1	C	A	6: 23,247,581	R165L	possibly damaging	Het
Fkbp15	A	T	4: 62,306,908	L838H	probably benign	Het
Frmd3	G	A	4: 74,153,610	G243D	probably damaging	Het
Gldc	A	T	19: 30,143,467		probably null	Het
Gm10188	T	C	1: 132,229,202		probably benign	Het
Gm5190	T	A	12: 113,397,239		noncoding transcript	Het
Hdhd5	A	G	6: 120,514,524	L206P	probably damaging	Het
Herc2	A	G	7: 56,124,248	N1149S	probably benign	Het
Inca1	G	A	11: 70,695,982		probably benign	Het
Iqch	G	A	9: 63,547,990	S175F	probably damaging	Het
Itpr3	T	G	17: 27,110,862	D1543E	probably benign	Het
Khk	T	A	5: 30,930,875		probably null	Het
Kiz	C	T	2: 146,889,601	S337L	probably damaging	Het
Lzts3	G	A	2: 130,636,539	T213I	probably damaging	Het
Mab21l2	T	A	3: 86,546,718	D325V	probably damaging	Het
Mctp2	A	G	7: 72,214,108	S336P	probably benign	Het
Me3	T	A	7: 89,848,006	L405Q	probably benign	Het
Mgst2	A	T	3: 51,661,230		probably benign	Het
Myh2	A	G	11: 67,192,504	E1431G	probably damaging	Het
Naip6	A	G	13: 100,299,673	S781P	probably damaging	Het
Nr3c2	A	G	8: 76,908,268		probably null	Het
Olfr509	A	T	7: 108,645,739	L279Q	probably damaging	Het
Olfr750	A	G	14: 51,070,992	Y134H	probably damaging	Het
Olfr986	C	T	9: 40,187,571	T152I	probably benign	Het
Otop1	G	T	5: 38,277,822	R132L	possibly damaging	Het
Parg	T	A	14: 32,217,662	D548E	possibly damaging	Het
Pcdhga4	G	T	18: 37,687,686	G763W	probably benign	Het
Pde10a	A	G	17: 8,949,372	N9S	possibly damaging	Het
Pi4k2a	T	C	19: 42,100,641	I147T	probably benign	Het
Polh	T	A	17: 46,194,325	T122S	probably damaging	Het
Ptpn13	T	C	5: 103,477,118	V96A	possibly damaging	Het
Ptpn6	C	A	6: 124,728,785	C132F	probably damaging	Het
Rbm19	T	A	5: 120,132,867	V585E	probably damaging	Het
Rp1l1	C	T	14: 64,028,906	P647L	probably benign	Het
Rrp1b	A	G	17: 32,047,675	E72G	probably damaging	Het
Shcbp1	A	T	8: 4,748,742	H392Q	probably benign	Het
Skiv2l	C	T	17: 34,846,117	R371Q	possibly damaging	Het
Slc13a5	G	A	11: 72,253,391	T287I	possibly damaging	Het
Slc22a27	T	A	19: 7,926,757	E5V	probably benign	Het
Slc38a2	A	G	15: 96,692,584	V293A	probably damaging	Het
Slco6d1	T	A	1: 98,463,836		probably benign	Het
Sri	G	C	5: 8,059,353	D46H	probably damaging	Het
Tango6	A	G	8: 106,689,168	D207G	possibly damaging	Het
Tigd4	T	C	3: 84,594,442	M222T	probably benign	Het
Tmem229a	T	C	6: 24,955,173	D194G	probably benign	Het
Trank1	T	C	9: 111,366,685	V1259A	possibly damaging	Het
Trdv5	T	C	14: 54,148,798	D70G	probably benign	Het
Trim52	T	A	14: 106,106,941	M11K	probably damaging	Het
Wdr62	A	G	7: 30,241,347	M882T	probably benign	Het
Ybx3	A	G	6: 131,367,763		probably null	Het
Zfand2b	A	G	1: 75,170,510		probably benign	Het
Zfp91	T	A	19: 12,770,320	T480S	possibly damaging	Het

Other mutations in Gria1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00475:Gria1	APN	11	57242941	nonsense	probably null
IGL00807:Gria1	APN	11	57012040	missense	probably benign
IGL00816:Gria1	APN	11	57317742	missense	possibly damaging	0.93
IGL01110:Gria1	APN	11	57289381	missense	probably damaging	1.00
IGL01116:Gria1	APN	11	57236975	missense	probably damaging	1.00
IGL01120:Gria1	APN	11	57317669	missense	probably damaging	0.99
IGL01843:Gria1	APN	11	57317774	missense	probably damaging	1.00
IGL02135:Gria1	APN	11	57185853	missense	probably damaging	1.00
IGL02308:Gria1	APN	11	57236924	missense	probably benign	0.00
IGL02554:Gria1	APN	11	57289488	missense	possibly damaging	0.72
IGL02813:Gria1	APN	11	57283584	missense	probably damaging	1.00
IGL03071:Gria1	APN	11	57012110	splice site	probably null
IGL03326:Gria1	APN	11	57317773	missense	probably damaging	1.00
PIT4445001:Gria1	UTSW	11	57185838	missense	probably damaging	1.00
R0087:Gria1	UTSW	11	57317712	missense	probably damaging	1.00
R0387:Gria1	UTSW	11	57309884	critical splice donor site	probably null
R0399:Gria1	UTSW	11	57186027	missense	probably damaging	0.97
R0502:Gria1	UTSW	11	57189716	missense	probably damaging	1.00
R0503:Gria1	UTSW	11	57189716	missense	probably damaging	1.00
R0549:Gria1	UTSW	11	57228973	missense	probably damaging	1.00
R0590:Gria1	UTSW	11	57289409	missense	probably damaging	1.00
R1377:Gria1	UTSW	11	57201176	missense	probably damaging	1.00
R1395:Gria1	UTSW	11	57283566	missense	probably damaging	1.00
R1422:Gria1	UTSW	11	57189788	missense	probably benign	0.00
R1581:Gria1	UTSW	11	57237010	splice site	probably null
R2002:Gria1	UTSW	11	57012104	missense	possibly damaging	0.93
R2064:Gria1	UTSW	11	57317708	missense	probably damaging	0.98
R2255:Gria1	UTSW	11	57185949	missense	probably damaging	1.00
R2507:Gria1	UTSW	11	57289320	missense	probably null	0.30
R2965:Gria1	UTSW	11	57185801	nonsense	probably null
R3012:Gria1	UTSW	11	57289434	missense	probably damaging	1.00
R3151:Gria1	UTSW	11	57283562	missense	probably damaging	1.00
R3807:Gria1	UTSW	11	57310678	missense	probably damaging	1.00
R5026:Gria1	UTSW	11	57310696	missense	probably damaging	1.00
R5132:Gria1	UTSW	11	57289399	missense	probably damaging	1.00
R5222:Gria1	UTSW	11	57189797	missense	probably benign	0.22
R5303:Gria1	UTSW	11	57243025	missense	probably benign	0.01
R5332:Gria1	UTSW	11	57327621	missense	possibly damaging	0.93
R5413:Gria1	UTSW	11	57217794	missense	probably benign	0.00
R5748:Gria1	UTSW	11	57309876	missense	probably benign	0.00
R5937:Gria1	UTSW	11	57189733	missense	probably benign	0.00
R5995:Gria1	UTSW	11	57289285	missense	probably damaging	1.00
R6031:Gria1	UTSW	11	57217782	missense	probably damaging	1.00
R6031:Gria1	UTSW	11	57217782	missense	probably damaging	1.00
R6180:Gria1	UTSW	11	57242792	missense	probably damaging	1.00
R6187:Gria1	UTSW	11	57238110	missense	possibly damaging	0.84
R6262:Gria1	UTSW	11	57242854	missense	probably damaging	1.00
R6828:Gria1	UTSW	11	57289462	missense	probably damaging	1.00
R7374:Gria1	UTSW	11	57189808	missense	probably benign
R7507:Gria1	UTSW	11	57228939	missense	probably benign	0.14
R7511:Gria1	UTSW	11	57283625	missense	probably damaging	1.00
R7691:Gria1	UTSW	11	57236987	missense	possibly damaging	0.94
R7898:Gria1	UTSW	11	57242765	missense	probably damaging	1.00
R7931:Gria1	UTSW	11	57310525	intron	probably benign
R7956:Gria1	UTSW	11	57189800	missense	possibly damaging	0.93
R8189:Gria1	UTSW	11	57217799	missense	probably benign	0.00
R8353:Gria1	UTSW	11	57243051	missense	probably damaging	1.00
R8453:Gria1	UTSW	11	57243051	missense	probably damaging	1.00
R8472:Gria1	UTSW	11	57327584	missense	probably benign	0.11
R8478:Gria1	UTSW	11	57309842	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTTGCTGCTGCCTCGATG -3'
(R):5'- TATTTGCCAGACACGGCCATC -3'

Sequencing Primer
(F):5'- CCTCGATGGCCTCAAGC -3'
(R):5'- GACACGGCCATCCCTTC -3'

Posted On

2017-02-10