Incidental Mutation 'R5878:Pde10a'
ID455680
Institutional Source Beutler Lab
Gene Symbol Pde10a
Ensembl Gene ENSMUSG00000023868
Gene Namephosphodiesterase 10A
Synonyms
MMRRC Submission 044084-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5878 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location8525372-8986648 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8949372 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 9 (N9S)
Ref Sequence ENSEMBL: ENSMUSP00000111373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024647] [ENSMUST00000089085] [ENSMUST00000115708] [ENSMUST00000115715] [ENSMUST00000115717] [ENSMUST00000115720] [ENSMUST00000115724] [ENSMUST00000149440] [ENSMUST00000231430]
Predicted Effect probably benign
Transcript: ENSMUST00000024647
AA Change: N213S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000024647
Gene: ENSMUSG00000023868
AA Change: N213S

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089085
AA Change: N293S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000086485
Gene: ENSMUSG00000023868
AA Change: N293S

DomainStartEndE-ValueType
GAF 101 254 1.44e-3 SMART
GAF 276 432 6.56e-29 SMART
HDc 522 688 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115708
AA Change: N9S

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111373
Gene: ENSMUSG00000023868
AA Change: N9S

DomainStartEndE-ValueType
GAF 3 148 5.22e-23 SMART
HDc 238 404 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115715
AA Change: N213S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000111380
Gene: ENSMUSG00000023868
AA Change: N213S

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115717
Predicted Effect probably benign
Transcript: ENSMUST00000115720
AA Change: N276S

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000111385
Gene: ENSMUSG00000023868
AA Change: N276S

DomainStartEndE-ValueType
GAF 84 237 1.44e-3 SMART
GAF 259 415 6.56e-29 SMART
HDc 505 671 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115724
AA Change: N347S

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000111389
Gene: ENSMUSG00000023868
AA Change: N347S

DomainStartEndE-ValueType
GAF 95 248 1.44e-3 SMART
GAF 270 426 6.56e-29 SMART
HDc 516 682 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149440
AA Change: N224S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000123216
Gene: ENSMUSG00000023868
AA Change: N224S

DomainStartEndE-ValueType
GAF 32 185 1.44e-3 SMART
GAF 207 363 6.56e-29 SMART
HDc 453 619 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231430
AA Change: N575S

PolyPhen 2 Score 0.203 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase family. It plays a role in signal transduction by regulating the intracellular concentration of cyclic nucleotides. This protein can hydrolyze both cAMP and cGMP to the corresponding nucleoside 5' monophosphate, but has higher affinity for cAMP, and is more efficient with cAMP as substrate. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in decreased exploratory behavior, hypoactivity, and a delay in the acquisition of conditioned avoidance behavior. A hypomorphic allele results in increased social behavior. Mice homozygous for a knock-out allele exhibit resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,692,960 S387T probably benign Het
Abca12 A T 1: 71,346,633 N275K possibly damaging Het
Abhd6 G A 14: 8,028,286 V6I probably benign Het
Afap1l2 T C 19: 56,915,675 T727A probably benign Het
Aggf1 T C 13: 95,369,557 E174G probably benign Het
Ahnak T G 19: 9,008,342 L2330R probably damaging Het
Arfgef2 A G 2: 166,870,217 T1205A probably benign Het
Ccdc3 T C 2: 5,229,016 L217P probably benign Het
Cfap54 T C 10: 92,964,561 D1595G probably benign Het
Cps1 G T 1: 67,157,878 probably null Het
Fam120b A G 17: 15,402,240 D160G probably damaging Het
Fam172a T A 13: 77,952,067 V129E probably damaging Het
Fezf1 C A 6: 23,247,581 R165L possibly damaging Het
Fkbp15 A T 4: 62,306,908 L838H probably benign Het
Frmd3 G A 4: 74,153,610 G243D probably damaging Het
Gldc A T 19: 30,143,467 probably null Het
Gm10188 T C 1: 132,229,202 probably benign Het
Gm5190 T A 12: 113,397,239 noncoding transcript Het
Gria1 T C 11: 57,317,802 probably null Het
Hdhd5 A G 6: 120,514,524 L206P probably damaging Het
Herc2 A G 7: 56,124,248 N1149S probably benign Het
Inca1 G A 11: 70,695,982 probably benign Het
Iqch G A 9: 63,547,990 S175F probably damaging Het
Itpr3 T G 17: 27,110,862 D1543E probably benign Het
Khk T A 5: 30,930,875 probably null Het
Kiz C T 2: 146,889,601 S337L probably damaging Het
Lzts3 G A 2: 130,636,539 T213I probably damaging Het
Mab21l2 T A 3: 86,546,718 D325V probably damaging Het
Mctp2 A G 7: 72,214,108 S336P probably benign Het
Me3 T A 7: 89,848,006 L405Q probably benign Het
Mgst2 A T 3: 51,661,230 probably benign Het
Myh2 A G 11: 67,192,504 E1431G probably damaging Het
Naip6 A G 13: 100,299,673 S781P probably damaging Het
Nr3c2 A G 8: 76,908,268 probably null Het
Olfr509 A T 7: 108,645,739 L279Q probably damaging Het
Olfr750 A G 14: 51,070,992 Y134H probably damaging Het
Olfr986 C T 9: 40,187,571 T152I probably benign Het
Otop1 G T 5: 38,277,822 R132L possibly damaging Het
Parg T A 14: 32,217,662 D548E possibly damaging Het
Pcdhga4 G T 18: 37,687,686 G763W probably benign Het
Pi4k2a T C 19: 42,100,641 I147T probably benign Het
Polh T A 17: 46,194,325 T122S probably damaging Het
Ptpn13 T C 5: 103,477,118 V96A possibly damaging Het
Ptpn6 C A 6: 124,728,785 C132F probably damaging Het
Rbm19 T A 5: 120,132,867 V585E probably damaging Het
Rp1l1 C T 14: 64,028,906 P647L probably benign Het
Rrp1b A G 17: 32,047,675 E72G probably damaging Het
Shcbp1 A T 8: 4,748,742 H392Q probably benign Het
Skiv2l C T 17: 34,846,117 R371Q possibly damaging Het
Slc13a5 G A 11: 72,253,391 T287I possibly damaging Het
Slc22a27 T A 19: 7,926,757 E5V probably benign Het
Slc38a2 A G 15: 96,692,584 V293A probably damaging Het
Slco6d1 T A 1: 98,463,836 probably benign Het
Sri G C 5: 8,059,353 D46H probably damaging Het
Tango6 A G 8: 106,689,168 D207G possibly damaging Het
Tigd4 T C 3: 84,594,442 M222T probably benign Het
Tmem229a T C 6: 24,955,173 D194G probably benign Het
Trank1 T C 9: 111,366,685 V1259A possibly damaging Het
Trdv5 T C 14: 54,148,798 D70G probably benign Het
Trim52 T A 14: 106,106,941 M11K probably damaging Het
Wdr62 A G 7: 30,241,347 M882T probably benign Het
Ybx3 A G 6: 131,367,763 probably null Het
Zfand2b A G 1: 75,170,510 probably benign Het
Zfp91 T A 19: 12,770,320 T480S possibly damaging Het
Other mutations in Pde10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Pde10a APN 17 8944970 missense probably damaging 1.00
IGL01762:Pde10a APN 17 8942918 missense possibly damaging 0.74
IGL01814:Pde10a APN 17 8929107 start codon destroyed probably null 0.00
IGL02053:Pde10a APN 17 8974769 missense probably damaging 1.00
IGL02386:Pde10a APN 17 8953804 missense possibly damaging 0.93
IGL02573:Pde10a APN 17 8961890 missense probably benign 0.38
IGL02583:Pde10a APN 17 8981630 missense probably benign 0.23
IGL02649:Pde10a APN 17 8953772 missense probably damaging 1.00
IGL02992:Pde10a APN 17 8949461 missense probably damaging 0.97
IGL03109:Pde10a APN 17 8929214 critical splice donor site probably null
Bride UTSW 17 8949430 missense possibly damaging 0.60
buzzed UTSW 17 8930537 missense probably damaging 1.00
nubile UTSW 17 8967462 missense probably damaging 1.00
thunderball UTSW 17 8969589 missense probably damaging 1.00
R0004:Pde10a UTSW 17 8981576 missense probably benign 0.00
R0015:Pde10a UTSW 17 8977197 missense probably damaging 1.00
R0015:Pde10a UTSW 17 8977197 missense probably damaging 1.00
R0650:Pde10a UTSW 17 8942965 missense probably damaging 1.00
R1173:Pde10a UTSW 17 8920546 splice site probably benign
R1386:Pde10a UTSW 17 8953742 missense probably damaging 1.00
R1458:Pde10a UTSW 17 8964708 missense probably damaging 0.98
R1598:Pde10a UTSW 17 8929144 missense probably damaging 1.00
R1661:Pde10a UTSW 17 8898870 missense probably damaging 1.00
R1665:Pde10a UTSW 17 8898870 missense probably damaging 1.00
R1883:Pde10a UTSW 17 8978944 missense possibly damaging 0.86
R1960:Pde10a UTSW 17 8942918 missense possibly damaging 0.74
R2005:Pde10a UTSW 17 8929091 critical splice acceptor site probably null
R2071:Pde10a UTSW 17 8961995 missense probably benign 0.22
R2121:Pde10a UTSW 17 8977215 missense probably damaging 1.00
R2376:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R3721:Pde10a UTSW 17 8969589 missense probably damaging 1.00
R3872:Pde10a UTSW 17 8757091 missense possibly damaging 0.92
R4627:Pde10a UTSW 17 8981652 missense probably damaging 1.00
R4652:Pde10a UTSW 17 8757053 missense possibly damaging 0.82
R5107:Pde10a UTSW 17 8944970 missense probably damaging 1.00
R5184:Pde10a UTSW 17 8977155 missense probably damaging 1.00
R5354:Pde10a UTSW 17 8961980 missense probably damaging 0.97
R5735:Pde10a UTSW 17 8941192 missense probably damaging 0.99
R5921:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R6027:Pde10a UTSW 17 8964677 missense possibly damaging 0.78
R6145:Pde10a UTSW 17 8929117 missense probably damaging 1.00
R6279:Pde10a UTSW 17 8978957 missense probably damaging 0.99
R6409:Pde10a UTSW 17 8949438 missense probably damaging 1.00
R6870:Pde10a UTSW 17 8967524 missense possibly damaging 0.56
R6947:Pde10a UTSW 17 8969592 missense probably damaging 1.00
R7072:Pde10a UTSW 17 8943026 missense probably benign 0.40
R7084:Pde10a UTSW 17 8941162 missense probably benign 0.25
R7294:Pde10a UTSW 17 8757021 missense probably benign
R7339:Pde10a UTSW 17 8757028 missense probably benign 0.01
R7347:Pde10a UTSW 17 8967462 missense probably damaging 1.00
R7373:Pde10a UTSW 17 8942992 missense probably benign 0.00
R7481:Pde10a UTSW 17 8949430 missense possibly damaging 0.60
R7833:Pde10a UTSW 17 8961920 missense possibly damaging 0.63
R7916:Pde10a UTSW 17 8961920 missense possibly damaging 0.63
R8053:Pde10a UTSW 17 8974772 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGGGATCAGCACGTAGACAG -3'
(R):5'- GGTACCACAGTATGACAAGTGTTG -3'

Sequencing Primer
(F):5'- ACGTGAATTCCACTGTGC -3'
(R):5'- ACAAGTGTTGTCAGCGCAC -3'
Posted On2017-02-10