Mutagenetix > Incidental Mutations

Incidental Mutation 'R5878:Skiv2l'

455683

Institutional Source

Beutler Lab

Gene Symbol

Skiv2l

Ensembl Gene

ENSMUSG00000040356

Gene Name

superkiller viralicidic activity 2-like (S. cerevisiae)

Synonyms

4930534J06Rik, Ski2w

MMRRC Submission

044084-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5878 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34839228-34850210 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 34846117 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 371 (R371Q)

Ref Sequence

ENSEMBL: ENSMUSP00000036265 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046022] [ENSMUST00000097343] [ENSMUST00000165953] [ENSMUST00000172966] [ENSMUST00000173065] [ENSMUST00000173357] [ENSMUST00000173415]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000046022
AA Change: R371Q

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000036265
Gene: ENSMUSG00000040356
AA Change: R371Q

Domain	Start	End	E-Value	Type
low complexity region	7	22	N/A	INTRINSIC
low complexity region	171	176	N/A	INTRINSIC
low complexity region	208	237	N/A	INTRINSIC
low complexity region	269	279	N/A	INTRINSIC
DEXDc	304	487	3.61e-28	SMART
low complexity region	583	592	N/A	INTRINSIC
HELICc	619	705	8.63e-17	SMART
Pfam:rRNA_proc-arch	760	1044	9.7e-39	PFAM
DSHCT	1067	1243	7.67e-77	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000097343

SMART Domains

Protein: ENSMUSP00000094956
Gene: ENSMUSG00000024369

Domain	Start	End	E-Value	Type
coiled coil region	7	36	N/A	INTRINSIC
low complexity region	147	167	N/A	INTRINSIC
low complexity region	184	239	N/A	INTRINSIC
RRM	259	324	7.25e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165953

SMART Domains

Protein: ENSMUSP00000131195
Gene: ENSMUSG00000024369

Domain	Start	End	E-Value	Type
coiled coil region	7	36	N/A	INTRINSIC
low complexity region	147	167	N/A	INTRINSIC
low complexity region	184	239	N/A	INTRINSIC
RRM	259	324	7.25e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172686

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172803

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172878

Predicted Effect

probably benign
Transcript: ENSMUST00000172966

Predicted Effect

probably benign
Transcript: ENSMUST00000173065

SMART Domains

Protein: ENSMUSP00000133934
Gene: ENSMUSG00000024369

Domain	Start	End	E-Value	Type
coiled coil region	7	36	N/A	INTRINSIC
low complexity region	147	167	N/A	INTRINSIC
low complexity region	184	228	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173305

Predicted Effect

probably benign
Transcript: ENSMUST00000173357

SMART Domains

Protein: ENSMUSP00000134272
Gene: ENSMUSG00000024369

Domain	Start	End	E-Value	Type
coiled coil region	7	36	N/A	INTRINSIC
low complexity region	147	167	N/A	INTRINSIC
low complexity region	184	239	N/A	INTRINSIC
RRM	259	324	7.25e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173403

Predicted Effect

probably benign
Transcript: ENSMUST00000173415

SMART Domains

Protein: ENSMUSP00000134209
Gene: ENSMUSG00000040356

Domain	Start	End	E-Value	Type
PDB:4A4Z\|A	10	81	8e-14	PDB
Blast:DEXDc	19	76	2e-29	BLAST
Blast:DEXDc	136	242	9e-28	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174226

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174363

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174887

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183497

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184474

Meta Mutation Damage Score

0.1178

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.7%

Validation Efficiency

99% (66/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a human homologue of yeast SKI2 and may be involved in antiviral activity by blocking translation of poly(A) deficient mRNAs. This gene is located in the class III region of the major histocompatibility complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,692,960	S387T	probably benign	Het
Abca12	A	T	1: 71,346,633	N275K	possibly damaging	Het
Abhd6	G	A	14: 8,028,286	V6I	probably benign	Het
Afap1l2	T	C	19: 56,915,675	T727A	probably benign	Het
Aggf1	T	C	13: 95,369,557	E174G	probably benign	Het
Ahnak	T	G	19: 9,008,342	L2330R	probably damaging	Het
Arfgef2	A	G	2: 166,870,217	T1205A	probably benign	Het
Ccdc3	T	C	2: 5,229,016	L217P	probably benign	Het
Cfap54	T	C	10: 92,964,561	D1595G	probably benign	Het
Cps1	G	T	1: 67,157,878		probably null	Het
Fam120b	A	G	17: 15,402,240	D160G	probably damaging	Het
Fam172a	T	A	13: 77,952,067	V129E	probably damaging	Het
Fezf1	C	A	6: 23,247,581	R165L	possibly damaging	Het
Fkbp15	A	T	4: 62,306,908	L838H	probably benign	Het
Frmd3	G	A	4: 74,153,610	G243D	probably damaging	Het
Gldc	A	T	19: 30,143,467		probably null	Het
Gm10188	T	C	1: 132,229,202		probably benign	Het
Gm5190	T	A	12: 113,397,239		noncoding transcript	Het
Gria1	T	C	11: 57,317,802		probably null	Het
Hdhd5	A	G	6: 120,514,524	L206P	probably damaging	Het
Herc2	A	G	7: 56,124,248	N1149S	probably benign	Het
Inca1	G	A	11: 70,695,982		probably benign	Het
Iqch	G	A	9: 63,547,990	S175F	probably damaging	Het
Itpr3	T	G	17: 27,110,862	D1543E	probably benign	Het
Khk	T	A	5: 30,930,875		probably null	Het
Kiz	C	T	2: 146,889,601	S337L	probably damaging	Het
Lzts3	G	A	2: 130,636,539	T213I	probably damaging	Het
Mab21l2	T	A	3: 86,546,718	D325V	probably damaging	Het
Mctp2	A	G	7: 72,214,108	S336P	probably benign	Het
Me3	T	A	7: 89,848,006	L405Q	probably benign	Het
Mgst2	A	T	3: 51,661,230		probably benign	Het
Myh2	A	G	11: 67,192,504	E1431G	probably damaging	Het
Naip6	A	G	13: 100,299,673	S781P	probably damaging	Het
Nr3c2	A	G	8: 76,908,268		probably null	Het
Olfr509	A	T	7: 108,645,739	L279Q	probably damaging	Het
Olfr750	A	G	14: 51,070,992	Y134H	probably damaging	Het
Olfr986	C	T	9: 40,187,571	T152I	probably benign	Het
Otop1	G	T	5: 38,277,822	R132L	possibly damaging	Het
Parg	T	A	14: 32,217,662	D548E	possibly damaging	Het
Pcdhga4	G	T	18: 37,687,686	G763W	probably benign	Het
Pde10a	A	G	17: 8,949,372	N9S	possibly damaging	Het
Pi4k2a	T	C	19: 42,100,641	I147T	probably benign	Het
Polh	T	A	17: 46,194,325	T122S	probably damaging	Het
Ptpn13	T	C	5: 103,477,118	V96A	possibly damaging	Het
Ptpn6	C	A	6: 124,728,785	C132F	probably damaging	Het
Rbm19	T	A	5: 120,132,867	V585E	probably damaging	Het
Rp1l1	C	T	14: 64,028,906	P647L	probably benign	Het
Rrp1b	A	G	17: 32,047,675	E72G	probably damaging	Het
Shcbp1	A	T	8: 4,748,742	H392Q	probably benign	Het
Slc13a5	G	A	11: 72,253,391	T287I	possibly damaging	Het
Slc22a27	T	A	19: 7,926,757	E5V	probably benign	Het
Slc38a2	A	G	15: 96,692,584	V293A	probably damaging	Het
Slco6d1	T	A	1: 98,463,836		probably benign	Het
Sri	G	C	5: 8,059,353	D46H	probably damaging	Het
Tango6	A	G	8: 106,689,168	D207G	possibly damaging	Het
Tigd4	T	C	3: 84,594,442	M222T	probably benign	Het
Tmem229a	T	C	6: 24,955,173	D194G	probably benign	Het
Trank1	T	C	9: 111,366,685	V1259A	possibly damaging	Het
Trdv5	T	C	14: 54,148,798	D70G	probably benign	Het
Trim52	T	A	14: 106,106,941	M11K	probably damaging	Het
Wdr62	A	G	7: 30,241,347	M882T	probably benign	Het
Ybx3	A	G	6: 131,367,763		probably null	Het
Zfand2b	A	G	1: 75,170,510		probably benign	Het
Zfp91	T	A	19: 12,770,320	T480S	possibly damaging	Het

Other mutations in Skiv2l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Skiv2l	APN	17	34839548	missense	probably damaging	1.00
IGL00338:Skiv2l	APN	17	34846667	missense	probably damaging	0.99
IGL01284:Skiv2l	APN	17	34839688	unclassified	probably benign
IGL01308:Skiv2l	APN	17	34840634	missense	probably benign	0.19
IGL01874:Skiv2l	APN	17	34841209	missense	probably benign
IGL02114:Skiv2l	APN	17	34841116	missense	probably damaging	0.97
IGL02208:Skiv2l	APN	17	34841675	missense	probably damaging	0.99
IGL02274:Skiv2l	APN	17	34845863	missense	probably damaging	1.00
IGL02729:Skiv2l	APN	17	34839605	missense	possibly damaging	0.63
IGL02839:Skiv2l	APN	17	34847798	missense	probably benign
R0325:Skiv2l	UTSW	17	34844815	missense	possibly damaging	0.50
R1102:Skiv2l	UTSW	17	34840106	missense	probably benign	0.28
R1294:Skiv2l	UTSW	17	34841064	splice site	probably null
R1513:Skiv2l	UTSW	17	34847444	missense	probably damaging	1.00
R1557:Skiv2l	UTSW	17	34848422	missense	probably damaging	1.00
R1747:Skiv2l	UTSW	17	34847806	missense	probably benign	0.02
R2401:Skiv2l	UTSW	17	34840385	missense	probably benign
R3162:Skiv2l	UTSW	17	34847813	nonsense	probably null
R3162:Skiv2l	UTSW	17	34847813	nonsense	probably null
R3695:Skiv2l	UTSW	17	34847912	missense	probably damaging	1.00
R3700:Skiv2l	UTSW	17	34849903	missense	probably benign
R4654:Skiv2l	UTSW	17	34849946	missense	probably damaging	1.00
R4736:Skiv2l	UTSW	17	34848197	missense	possibly damaging	0.91
R4835:Skiv2l	UTSW	17	34842921	missense	possibly damaging	0.66
R5014:Skiv2l	UTSW	17	34847425	missense	probably benign	0.00
R5181:Skiv2l	UTSW	17	34844826	missense	probably benign	0.44
R5223:Skiv2l	UTSW	17	34845166	critical splice donor site	probably null
R5417:Skiv2l	UTSW	17	34846598	missense	probably damaging	0.98
R5623:Skiv2l	UTSW	17	34847432	missense	probably benign	0.00
R5979:Skiv2l	UTSW	17	34841463	missense	probably benign	0.01
R6412:Skiv2l	UTSW	17	34840300	missense	possibly damaging	0.92
R6501:Skiv2l	UTSW	17	34844436	missense	possibly damaging	0.95
R6532:Skiv2l	UTSW	17	34844743	missense	probably damaging	1.00
R6730:Skiv2l	UTSW	17	34845190	nonsense	probably null
R6732:Skiv2l	UTSW	17	34845190	nonsense	probably null
R6741:Skiv2l	UTSW	17	34845190	nonsense	probably null
R6742:Skiv2l	UTSW	17	34845190	nonsense	probably null
R6769:Skiv2l	UTSW	17	34845190	nonsense	probably null
R6771:Skiv2l	UTSW	17	34845190	nonsense	probably null
R7022:Skiv2l	UTSW	17	34845207	missense	possibly damaging	0.88
R7096:Skiv2l	UTSW	17	34841470	missense	probably benign
R7178:Skiv2l	UTSW	17	34839464	missense	probably benign
R7315:Skiv2l	UTSW	17	34841169	missense	probably benign	0.00
R7584:Skiv2l	UTSW	17	34841675	missense	possibly damaging	0.69
R7677:Skiv2l	UTSW	17	34848164	missense	probably benign	0.03
R7796:Skiv2l	UTSW	17	34844418	missense	probably damaging	1.00
Z1176:Skiv2l	UTSW	17	34841546	missense	not run

Predicted Primers

PCR Primer
(F):5'- AGCCACTGTACAGCATGGAG -3'
(R):5'- GTATGCAAGAGTCATTAGTGTACAGG -3'

Sequencing Primer
(F):5'- GAGGAAGCTCAGACTGACCC -3'
(R):5'- CATTAGTGTACAGGACATGAGCCTTG -3'

Posted On

2017-02-10