Mutagenetix > Incidental Mutations

Incidental Mutation 'R5878:Polh'

455684

Institutional Source

Beutler Lab

Gene Symbol

Polh

Ensembl Gene

ENSMUSG00000023953

Gene Name

polymerase (DNA directed), eta (RAD 30 related)

Synonyms

RAD30A

MMRRC Submission

044084-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.427) question?

Stock #

R5878 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46172004-46202625 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 46194325 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 122 (T122S)

Ref Sequence

ENSEMBL: ENSMUSP00000024749 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024749]

Predicted Effect

probably damaging
Transcript: ENSMUST00000024749
AA Change: T122S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000024749
Gene: ENSMUSG00000023953
AA Change: T122S

Domain	Start	End	E-Value	Type
Pfam:IMS	12	227	9.7e-53	PFAM
Pfam:IMS_C	308	435	5.8e-15	PFAM
low complexity region	515	529	N/A	INTRINSIC
low complexity region	540	561	N/A	INTRINSIC
PDB:2I5O\|A	606	643	7e-15	PDB

Meta Mutation Damage Score

0.7158

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.7%

Validation Efficiency

99% (66/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Y family of specialized DNA polymerases. It copies undamaged DNA with a lower fidelity than other DNA-directed polymerases. However, it accurately replicates UV-damaged DNA; when thymine dimers are present, this polymerase inserts the complementary nucleotides in the newly synthesized DNA, thereby bypassing the lesion and suppressing the mutagenic effect of UV-induced DNA damage. This polymerase is thought to be involved in hypermutation during immunoglobulin class switch recombination. Mutations in this gene result in XPV, a variant type of xeroderma pigmentosum. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous inactivation of this gene causes increased susceptibility to UV-induced skin tumors and results in reduced immunoglobulin gene mutations at A-T base pairs with a G-C biased mutation pattern. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,692,960	S387T	probably benign	Het
Abca12	A	T	1: 71,346,633	N275K	possibly damaging	Het
Abhd6	G	A	14: 8,028,286	V6I	probably benign	Het
Afap1l2	T	C	19: 56,915,675	T727A	probably benign	Het
Aggf1	T	C	13: 95,369,557	E174G	probably benign	Het
Ahnak	T	G	19: 9,008,342	L2330R	probably damaging	Het
Arfgef2	A	G	2: 166,870,217	T1205A	probably benign	Het
Ccdc3	T	C	2: 5,229,016	L217P	probably benign	Het
Cfap54	T	C	10: 92,964,561	D1595G	probably benign	Het
Cps1	G	T	1: 67,157,878		probably null	Het
Fam120b	A	G	17: 15,402,240	D160G	probably damaging	Het
Fam172a	T	A	13: 77,952,067	V129E	probably damaging	Het
Fezf1	C	A	6: 23,247,581	R165L	possibly damaging	Het
Fkbp15	A	T	4: 62,306,908	L838H	probably benign	Het
Frmd3	G	A	4: 74,153,610	G243D	probably damaging	Het
Gldc	A	T	19: 30,143,467		probably null	Het
Gm10188	T	C	1: 132,229,202		probably benign	Het
Gm5190	T	A	12: 113,397,239		noncoding transcript	Het
Gria1	T	C	11: 57,317,802		probably null	Het
Hdhd5	A	G	6: 120,514,524	L206P	probably damaging	Het
Herc2	A	G	7: 56,124,248	N1149S	probably benign	Het
Inca1	G	A	11: 70,695,982		probably benign	Het
Iqch	G	A	9: 63,547,990	S175F	probably damaging	Het
Itpr3	T	G	17: 27,110,862	D1543E	probably benign	Het
Khk	T	A	5: 30,930,875		probably null	Het
Kiz	C	T	2: 146,889,601	S337L	probably damaging	Het
Lzts3	G	A	2: 130,636,539	T213I	probably damaging	Het
Mab21l2	T	A	3: 86,546,718	D325V	probably damaging	Het
Mctp2	A	G	7: 72,214,108	S336P	probably benign	Het
Me3	T	A	7: 89,848,006	L405Q	probably benign	Het
Mgst2	A	T	3: 51,661,230		probably benign	Het
Myh2	A	G	11: 67,192,504	E1431G	probably damaging	Het
Naip6	A	G	13: 100,299,673	S781P	probably damaging	Het
Nr3c2	A	G	8: 76,908,268		probably null	Het
Olfr509	A	T	7: 108,645,739	L279Q	probably damaging	Het
Olfr750	A	G	14: 51,070,992	Y134H	probably damaging	Het
Olfr986	C	T	9: 40,187,571	T152I	probably benign	Het
Otop1	G	T	5: 38,277,822	R132L	possibly damaging	Het
Parg	T	A	14: 32,217,662	D548E	possibly damaging	Het
Pcdhga4	G	T	18: 37,687,686	G763W	probably benign	Het
Pde10a	A	G	17: 8,949,372	N9S	possibly damaging	Het
Pi4k2a	T	C	19: 42,100,641	I147T	probably benign	Het
Ptpn13	T	C	5: 103,477,118	V96A	possibly damaging	Het
Ptpn6	C	A	6: 124,728,785	C132F	probably damaging	Het
Rbm19	T	A	5: 120,132,867	V585E	probably damaging	Het
Rp1l1	C	T	14: 64,028,906	P647L	probably benign	Het
Rrp1b	A	G	17: 32,047,675	E72G	probably damaging	Het
Shcbp1	A	T	8: 4,748,742	H392Q	probably benign	Het
Skiv2l	C	T	17: 34,846,117	R371Q	possibly damaging	Het
Slc13a5	G	A	11: 72,253,391	T287I	possibly damaging	Het
Slc22a27	T	A	19: 7,926,757	E5V	probably benign	Het
Slc38a2	A	G	15: 96,692,584	V293A	probably damaging	Het
Slco6d1	T	A	1: 98,463,836		probably benign	Het
Sri	G	C	5: 8,059,353	D46H	probably damaging	Het
Tango6	A	G	8: 106,689,168	D207G	possibly damaging	Het
Tigd4	T	C	3: 84,594,442	M222T	probably benign	Het
Tmem229a	T	C	6: 24,955,173	D194G	probably benign	Het
Trank1	T	C	9: 111,366,685	V1259A	possibly damaging	Het
Trdv5	T	C	14: 54,148,798	D70G	probably benign	Het
Trim52	T	A	14: 106,106,941	M11K	probably damaging	Het
Wdr62	A	G	7: 30,241,347	M882T	probably benign	Het
Ybx3	A	G	6: 131,367,763		probably null	Het
Zfand2b	A	G	1: 75,170,510		probably benign	Het
Zfp91	T	A	19: 12,770,320	T480S	possibly damaging	Het

Other mutations in Polh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Polh	APN	17	46172243	unclassified	probably benign
IGL00585:Polh	APN	17	46172243	unclassified	probably benign
IGL01812:Polh	APN	17	46172911	missense	probably benign	0.04
IGL01996:Polh	APN	17	46173001	missense	probably benign	0.00
IGL02578:Polh	APN	17	46194292	nonsense	probably null
IGL02829:Polh	APN	17	46172902	missense	possibly damaging	0.82
IGL03003:Polh	APN	17	46194366	missense	possibly damaging	0.57
R1435:Polh	UTSW	17	46194255	missense	probably damaging	1.00
R2091:Polh	UTSW	17	46181454	splice site	probably benign
R2129:Polh	UTSW	17	46188088	nonsense	probably null
R4226:Polh	UTSW	17	46172594	missense	probably benign
R4227:Polh	UTSW	17	46172594	missense	probably benign
R5483:Polh	UTSW	17	46172745	missense	probably benign	0.01
R6039:Polh	UTSW	17	46188033	missense	probably benign	0.00
R6039:Polh	UTSW	17	46188033	missense	probably benign	0.00
R6177:Polh	UTSW	17	46184744	missense	possibly damaging	0.94
R6345:Polh	UTSW	17	46182738	missense	probably benign	0.03
R6545:Polh	UTSW	17	46182759	missense	possibly damaging	0.74
R6712:Polh	UTSW	17	46190729	missense	probably benign	0.12
R7054:Polh	UTSW	17	46198716	missense	probably benign	0.24
R7708:Polh	UTSW	17	46172700	missense	probably benign	0.00
R7855:Polh	UTSW	17	46175248	missense	probably damaging	1.00
R7938:Polh	UTSW	17	46175248	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGCTTAGCCACGAAAAGC -3'
(R):5'- TGTTGCATCTCTATTAAGCCACTTG -3'

Sequencing Primer
(F):5'- CTTAGCCACGAAAAGCAGCAGG -3'
(R):5'- GCCACTTGCTACTTGCTTATGG -3'

Posted On

2017-02-10