Incidental Mutation 'R5878:Slc22a27'
ID455686
Institutional Source Beutler Lab
Gene Symbol Slc22a27
Ensembl Gene ENSMUSG00000067656
Gene Namesolute carrier family 22, member 27
SynonymsmOAT6 related protein, AB056442
MMRRC Submission 044084-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R5878 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location7864388-7966027 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7926757 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 5 (E5V)
Ref Sequence ENSEMBL: ENSMUSP00000138475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075619] [ENSMUST00000182102]
Predicted Effect probably benign
Transcript: ENSMUST00000075619
AA Change: E5V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000093991
Gene: ENSMUSG00000067656
AA Change: E5V

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 528 1.5e-25 PFAM
Pfam:MFS_1 140 372 1.3e-15 PFAM
Pfam:MFS_1 349 549 8.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182102
AA Change: E5V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000138475
Gene: ENSMUSG00000067656
AA Change: E5V

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:MFS_1 241 441 1.2e-11 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 99% (66/67)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,692,960 S387T probably benign Het
Abca12 A T 1: 71,346,633 N275K possibly damaging Het
Abhd6 G A 14: 8,028,286 V6I probably benign Het
Afap1l2 T C 19: 56,915,675 T727A probably benign Het
Aggf1 T C 13: 95,369,557 E174G probably benign Het
Ahnak T G 19: 9,008,342 L2330R probably damaging Het
Arfgef2 A G 2: 166,870,217 T1205A probably benign Het
Ccdc3 T C 2: 5,229,016 L217P probably benign Het
Cfap54 T C 10: 92,964,561 D1595G probably benign Het
Cps1 G T 1: 67,157,878 probably null Het
Fam120b A G 17: 15,402,240 D160G probably damaging Het
Fam172a T A 13: 77,952,067 V129E probably damaging Het
Fezf1 C A 6: 23,247,581 R165L possibly damaging Het
Fkbp15 A T 4: 62,306,908 L838H probably benign Het
Frmd3 G A 4: 74,153,610 G243D probably damaging Het
Gldc A T 19: 30,143,467 probably null Het
Gm10188 T C 1: 132,229,202 probably benign Het
Gm5190 T A 12: 113,397,239 noncoding transcript Het
Gria1 T C 11: 57,317,802 probably null Het
Hdhd5 A G 6: 120,514,524 L206P probably damaging Het
Herc2 A G 7: 56,124,248 N1149S probably benign Het
Inca1 G A 11: 70,695,982 probably benign Het
Iqch G A 9: 63,547,990 S175F probably damaging Het
Itpr3 T G 17: 27,110,862 D1543E probably benign Het
Khk T A 5: 30,930,875 probably null Het
Kiz C T 2: 146,889,601 S337L probably damaging Het
Lzts3 G A 2: 130,636,539 T213I probably damaging Het
Mab21l2 T A 3: 86,546,718 D325V probably damaging Het
Mctp2 A G 7: 72,214,108 S336P probably benign Het
Me3 T A 7: 89,848,006 L405Q probably benign Het
Mgst2 A T 3: 51,661,230 probably benign Het
Myh2 A G 11: 67,192,504 E1431G probably damaging Het
Naip6 A G 13: 100,299,673 S781P probably damaging Het
Nr3c2 A G 8: 76,908,268 probably null Het
Olfr509 A T 7: 108,645,739 L279Q probably damaging Het
Olfr750 A G 14: 51,070,992 Y134H probably damaging Het
Olfr986 C T 9: 40,187,571 T152I probably benign Het
Otop1 G T 5: 38,277,822 R132L possibly damaging Het
Parg T A 14: 32,217,662 D548E possibly damaging Het
Pcdhga4 G T 18: 37,687,686 G763W probably benign Het
Pde10a A G 17: 8,949,372 N9S possibly damaging Het
Pi4k2a T C 19: 42,100,641 I147T probably benign Het
Polh T A 17: 46,194,325 T122S probably damaging Het
Ptpn13 T C 5: 103,477,118 V96A possibly damaging Het
Ptpn6 C A 6: 124,728,785 C132F probably damaging Het
Rbm19 T A 5: 120,132,867 V585E probably damaging Het
Rp1l1 C T 14: 64,028,906 P647L probably benign Het
Rrp1b A G 17: 32,047,675 E72G probably damaging Het
Shcbp1 A T 8: 4,748,742 H392Q probably benign Het
Skiv2l C T 17: 34,846,117 R371Q possibly damaging Het
Slc13a5 G A 11: 72,253,391 T287I possibly damaging Het
Slc38a2 A G 15: 96,692,584 V293A probably damaging Het
Slco6d1 T A 1: 98,463,836 probably benign Het
Sri G C 5: 8,059,353 D46H probably damaging Het
Tango6 A G 8: 106,689,168 D207G possibly damaging Het
Tigd4 T C 3: 84,594,442 M222T probably benign Het
Tmem229a T C 6: 24,955,173 D194G probably benign Het
Trank1 T C 9: 111,366,685 V1259A possibly damaging Het
Trdv5 T C 14: 54,148,798 D70G probably benign Het
Trim52 T A 14: 106,106,941 M11K probably damaging Het
Wdr62 A G 7: 30,241,347 M882T probably benign Het
Ybx3 A G 6: 131,367,763 probably null Het
Zfand2b A G 1: 75,170,510 probably benign Het
Zfp91 T A 19: 12,770,320 T480S possibly damaging Het
Other mutations in Slc22a27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01994:Slc22a27 APN 19 7909743 missense possibly damaging 0.93
IGL02516:Slc22a27 APN 19 7864811 missense probably damaging 0.99
IGL02961:Slc22a27 APN 19 7926521 missense probably damaging 0.99
IGL03008:Slc22a27 APN 19 7909702 missense possibly damaging 0.92
PIT4544001:Slc22a27 UTSW 19 7909738 missense probably damaging 1.00
R0172:Slc22a27 UTSW 19 7865836 nonsense probably null
R0234:Slc22a27 UTSW 19 7926791 start gained probably benign
R0234:Slc22a27 UTSW 19 7926791 start gained probably benign
R0280:Slc22a27 UTSW 19 7896822 nonsense probably null
R0561:Slc22a27 UTSW 19 7880162 critical splice donor site probably null
R0597:Slc22a27 UTSW 19 7865884 missense probably benign 0.00
R1005:Slc22a27 UTSW 19 7926751 missense probably damaging 1.00
R1165:Slc22a27 UTSW 19 7909694 intron probably null
R1217:Slc22a27 UTSW 19 7926668 missense probably benign 0.01
R1533:Slc22a27 UTSW 19 7866983 missense possibly damaging 0.79
R1940:Slc22a27 UTSW 19 7909727 missense probably damaging 1.00
R3714:Slc22a27 UTSW 19 7926450 missense possibly damaging 0.75
R3959:Slc22a27 UTSW 19 7910049 missense probably damaging 1.00
R4059:Slc22a27 UTSW 19 7879608 splice site probably benign
R4249:Slc22a27 UTSW 19 7925879 missense possibly damaging 0.64
R4748:Slc22a27 UTSW 19 7925876 missense probably benign
R5220:Slc22a27 UTSW 19 7865938 missense probably damaging 0.96
R5221:Slc22a27 UTSW 19 7865938 missense probably damaging 0.96
R5232:Slc22a27 UTSW 19 7865938 missense probably damaging 0.96
R5330:Slc22a27 UTSW 19 7879455 missense probably benign 0.13
R5331:Slc22a27 UTSW 19 7879455 missense probably benign 0.13
R5345:Slc22a27 UTSW 19 7865938 missense probably damaging 0.96
R5427:Slc22a27 UTSW 19 7879388 critical splice donor site probably null
R5534:Slc22a27 UTSW 19 7926631 missense probably damaging 1.00
R5691:Slc22a27 UTSW 19 7926670 missense possibly damaging 0.90
R5828:Slc22a27 UTSW 19 7926402 missense probably damaging 1.00
R5918:Slc22a27 UTSW 19 7910046 missense possibly damaging 0.91
R6185:Slc22a27 UTSW 19 7926588 missense probably benign 0.14
R6901:Slc22a27 UTSW 19 7926579 missense probably damaging 1.00
R7139:Slc22a27 UTSW 19 7926547 missense probably damaging 1.00
R7336:Slc22a27 UTSW 19 7926689 missense probably benign 0.02
R7502:Slc22a27 UTSW 19 7926382 missense probably damaging 1.00
R7556:Slc22a27 UTSW 19 7865754 missense probably damaging 0.98
R7737:Slc22a27 UTSW 19 7896762 missense probably damaging 0.99
R7860:Slc22a27 UTSW 19 7910107 critical splice acceptor site probably null
R8050:Slc22a27 UTSW 19 7880167 missense probably benign 0.18
R8090:Slc22a27 UTSW 19 7865736 splice site probably null
R8150:Slc22a27 UTSW 19 7910025 missense possibly damaging 0.87
RF012:Slc22a27 UTSW 19 7926584 missense probably benign 0.07
Z1177:Slc22a27 UTSW 19 7909730 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGGCTCAGGATCCTACTGC -3'
(R):5'- GGCTCCATACCTAACATTTAGCTCAC -3'

Sequencing Primer
(F):5'- GGATCCTACTGCCATTATCAGAGG -3'
(R):5'- GCTCACTAGAGGGTAATGCTACTC -3'
Posted On2017-02-10