Mutagenetix > Incidental Mutations

Incidental Mutation 'R5878:Pi4k2a'

455690

Institutional Source

Beutler Lab

Gene Symbol

Pi4k2a

Ensembl Gene

ENSMUSG00000025178

Gene Name

phosphatidylinositol 4-kinase type 2 alpha

Synonyms

MMRRC Submission

044084-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.908) question?

Stock #

R5878 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

42090435-42122218 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 42100641 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 147 (I147T)

Ref Sequence

ENSEMBL: ENSMUSP00000069284 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066778]

Predicted Effect

probably benign
Transcript: ENSMUST00000066778
AA Change: I147T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000069284
Gene: ENSMUSG00000025178
AA Change: I147T

Domain	Start	End	E-Value	Type
low complexity region	31	53	N/A	INTRINSIC
low complexity region	68	98	N/A	INTRINSIC
Pfam:PI3_PI4_kinase	133	431	1.7e-67	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.7%

Validation Efficiency

99% (66/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositolpolyphosphates (PtdInsPs) are centrally involved in many biologic processes, ranging from cell growth and organization of the actin cytoskeleton to endo- and exocytosis. PI4KII phosphorylates PtdIns at the D-4 position, an essential step in the biosynthesis of PtdInsPs (Barylko et al., 2001 [PubMed 11244087]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele develop a progressive neurologic disease typified by urinary incontinence, tremor, limb weakness, weight loss, cerebellar gliosis, Purkinje cell loss, degeneration of spinal cord axons and premature death. Mutant males are sterile while females are subfertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,692,960	S387T	probably benign	Het
Abca12	A	T	1: 71,346,633	N275K	possibly damaging	Het
Abhd6	G	A	14: 8,028,286	V6I	probably benign	Het
Afap1l2	T	C	19: 56,915,675	T727A	probably benign	Het
Aggf1	T	C	13: 95,369,557	E174G	probably benign	Het
Ahnak	T	G	19: 9,008,342	L2330R	probably damaging	Het
Arfgef2	A	G	2: 166,870,217	T1205A	probably benign	Het
Ccdc3	T	C	2: 5,229,016	L217P	probably benign	Het
Cfap54	T	C	10: 92,964,561	D1595G	probably benign	Het
Cps1	G	T	1: 67,157,878		probably null	Het
Fam120b	A	G	17: 15,402,240	D160G	probably damaging	Het
Fam172a	T	A	13: 77,952,067	V129E	probably damaging	Het
Fezf1	C	A	6: 23,247,581	R165L	possibly damaging	Het
Fkbp15	A	T	4: 62,306,908	L838H	probably benign	Het
Frmd3	G	A	4: 74,153,610	G243D	probably damaging	Het
Gldc	A	T	19: 30,143,467		probably null	Het
Gm10188	T	C	1: 132,229,202		probably benign	Het
Gm5190	T	A	12: 113,397,239		noncoding transcript	Het
Gria1	T	C	11: 57,317,802		probably null	Het
Hdhd5	A	G	6: 120,514,524	L206P	probably damaging	Het
Herc2	A	G	7: 56,124,248	N1149S	probably benign	Het
Inca1	G	A	11: 70,695,982		probably benign	Het
Iqch	G	A	9: 63,547,990	S175F	probably damaging	Het
Itpr3	T	G	17: 27,110,862	D1543E	probably benign	Het
Khk	T	A	5: 30,930,875		probably null	Het
Kiz	C	T	2: 146,889,601	S337L	probably damaging	Het
Lzts3	G	A	2: 130,636,539	T213I	probably damaging	Het
Mab21l2	T	A	3: 86,546,718	D325V	probably damaging	Het
Mctp2	A	G	7: 72,214,108	S336P	probably benign	Het
Me3	T	A	7: 89,848,006	L405Q	probably benign	Het
Mgst2	A	T	3: 51,661,230		probably benign	Het
Myh2	A	G	11: 67,192,504	E1431G	probably damaging	Het
Naip6	A	G	13: 100,299,673	S781P	probably damaging	Het
Nr3c2	A	G	8: 76,908,268		probably null	Het
Olfr509	A	T	7: 108,645,739	L279Q	probably damaging	Het
Olfr750	A	G	14: 51,070,992	Y134H	probably damaging	Het
Olfr986	C	T	9: 40,187,571	T152I	probably benign	Het
Otop1	G	T	5: 38,277,822	R132L	possibly damaging	Het
Parg	T	A	14: 32,217,662	D548E	possibly damaging	Het
Pcdhga4	G	T	18: 37,687,686	G763W	probably benign	Het
Pde10a	A	G	17: 8,949,372	N9S	possibly damaging	Het
Polh	T	A	17: 46,194,325	T122S	probably damaging	Het
Ptpn13	T	C	5: 103,477,118	V96A	possibly damaging	Het
Ptpn6	C	A	6: 124,728,785	C132F	probably damaging	Het
Rbm19	T	A	5: 120,132,867	V585E	probably damaging	Het
Rp1l1	C	T	14: 64,028,906	P647L	probably benign	Het
Rrp1b	A	G	17: 32,047,675	E72G	probably damaging	Het
Shcbp1	A	T	8: 4,748,742	H392Q	probably benign	Het
Skiv2l	C	T	17: 34,846,117	R371Q	possibly damaging	Het
Slc13a5	G	A	11: 72,253,391	T287I	possibly damaging	Het
Slc22a27	T	A	19: 7,926,757	E5V	probably benign	Het
Slc38a2	A	G	15: 96,692,584	V293A	probably damaging	Het
Slco6d1	T	A	1: 98,463,836		probably benign	Het
Sri	G	C	5: 8,059,353	D46H	probably damaging	Het
Tango6	A	G	8: 106,689,168	D207G	possibly damaging	Het
Tigd4	T	C	3: 84,594,442	M222T	probably benign	Het
Tmem229a	T	C	6: 24,955,173	D194G	probably benign	Het
Trank1	T	C	9: 111,366,685	V1259A	possibly damaging	Het
Trdv5	T	C	14: 54,148,798	D70G	probably benign	Het
Trim52	T	A	14: 106,106,941	M11K	probably damaging	Het
Wdr62	A	G	7: 30,241,347	M882T	probably benign	Het
Ybx3	A	G	6: 131,367,763		probably null	Het
Zfand2b	A	G	1: 75,170,510		probably benign	Het
Zfp91	T	A	19: 12,770,320	T480S	possibly damaging	Het

Other mutations in Pi4k2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01710:Pi4k2a	APN	19	42104979	missense	probably damaging	1.00
IGL02959:Pi4k2a	APN	19	42113071	missense	probably benign	0.42
R1570:Pi4k2a	UTSW	19	42100644	missense	probably benign	0.33
R1992:Pi4k2a	UTSW	19	42115938	missense	probably damaging	1.00
R2113:Pi4k2a	UTSW	19	42115071	missense	possibly damaging	0.78
R2358:Pi4k2a	UTSW	19	42090692	missense	probably damaging	0.99
R2410:Pi4k2a	UTSW	19	42104877	missense	possibly damaging	0.55
R3547:Pi4k2a	UTSW	19	42090548	missense	probably benign	0.10
R3708:Pi4k2a	UTSW	19	42090931	nonsense	probably null
R3712:Pi4k2a	UTSW	19	42090692	missense	probably damaging	0.99
R3954:Pi4k2a	UTSW	19	42115899	missense	probably damaging	0.98
R4654:Pi4k2a	UTSW	19	42113105	critical splice donor site	probably null
R5077:Pi4k2a	UTSW	19	42119836	splice site	probably null
R5386:Pi4k2a	UTSW	19	42090515	missense	probably damaging	0.99
R5846:Pi4k2a	UTSW	19	42115038	missense	probably benign	0.01
R5867:Pi4k2a	UTSW	19	42105485	critical splice donor site	probably null
R6502:Pi4k2a	UTSW	19	42090932	missense	probably benign	0.04
R7042:Pi4k2a	UTSW	19	42104898	missense	probably benign	0.18
R7269:Pi4k2a	UTSW	19	42090686	missense	probably damaging	1.00
R7819:Pi4k2a	UTSW	19	42090574	missense	probably benign
R8249:Pi4k2a	UTSW	19	42115062	missense	probably benign	0.00
Z1177:Pi4k2a	UTSW	19	42104925	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GCAAGAAAGTCTCAGGGGTCTG -3'
(R):5'- AACTCAGGGACATGGCAAGC -3'

Sequencing Primer
(F):5'- AAGAAAGTCTCAGGGGTCTGGTATTG -3'
(R):5'- ACTGACCTTTGTACGTGGTAC -3'

Posted On

2017-02-10