Incidental Mutation 'R5878:Afap1l2'
ID455691
Institutional Source Beutler Lab
Gene Symbol Afap1l2
Ensembl Gene ENSMUSG00000025083
Gene Nameactin filament associated protein 1-like 2
Synonyms
MMRRC Submission 044084-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R5878 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location56912361-57008228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56915675 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 727 (T727A)
Ref Sequence ENSEMBL: ENSMUSP00000107210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026068] [ENSMUST00000111584] [ENSMUST00000118800] [ENSMUST00000122359]
Predicted Effect probably benign
Transcript: ENSMUST00000026068
SMART Domains Protein: ENSMUSP00000026068
Gene: ENSMUSG00000025082

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 49 222 6.9e-35 SMART
EGF 297 332 2.99e-4 SMART
VWA 340 517 1.26e-28 SMART
VWA 528 705 1.55e-37 SMART
EGF 714 747 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111584
AA Change: T727A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000107210
Gene: ENSMUSG00000025083
AA Change: T727A

DomainStartEndE-ValueType
Blast:PH 30 153 3e-60 BLAST
low complexity region 160 170 N/A INTRINSIC
PH 194 291 9.27e-9 SMART
PH 372 467 3.11e-10 SMART
low complexity region 531 543 N/A INTRINSIC
low complexity region 611 626 N/A INTRINSIC
coiled coil region 675 772 N/A INTRINSIC
low complexity region 791 804 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118800
AA Change: T709A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000113745
Gene: ENSMUSG00000025083
AA Change: T709A

DomainStartEndE-ValueType
Blast:PH 12 135 3e-60 BLAST
low complexity region 142 152 N/A INTRINSIC
PH 176 273 9.27e-9 SMART
PH 354 449 3.11e-10 SMART
low complexity region 513 525 N/A INTRINSIC
low complexity region 593 608 N/A INTRINSIC
coiled coil region 657 754 N/A INTRINSIC
low complexity region 773 786 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122359
AA Change: T653A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000112387
Gene: ENSMUSG00000025083
AA Change: T653A

DomainStartEndE-ValueType
Blast:PH 1 79 3e-32 BLAST
low complexity region 86 96 N/A INTRINSIC
PH 120 217 9.27e-9 SMART
PH 298 393 3.11e-10 SMART
low complexity region 457 469 N/A INTRINSIC
low complexity region 537 552 N/A INTRINSIC
coiled coil region 601 698 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155467
Meta Mutation Damage Score 0.0675 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 99% (66/67)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,692,960 S387T probably benign Het
Abca12 A T 1: 71,346,633 N275K possibly damaging Het
Abhd6 G A 14: 8,028,286 V6I probably benign Het
Aggf1 T C 13: 95,369,557 E174G probably benign Het
Ahnak T G 19: 9,008,342 L2330R probably damaging Het
Arfgef2 A G 2: 166,870,217 T1205A probably benign Het
Ccdc3 T C 2: 5,229,016 L217P probably benign Het
Cfap54 T C 10: 92,964,561 D1595G probably benign Het
Cps1 G T 1: 67,157,878 probably null Het
Fam120b A G 17: 15,402,240 D160G probably damaging Het
Fam172a T A 13: 77,952,067 V129E probably damaging Het
Fezf1 C A 6: 23,247,581 R165L possibly damaging Het
Fkbp15 A T 4: 62,306,908 L838H probably benign Het
Frmd3 G A 4: 74,153,610 G243D probably damaging Het
Gldc A T 19: 30,143,467 probably null Het
Gm10188 T C 1: 132,229,202 probably benign Het
Gm5190 T A 12: 113,397,239 noncoding transcript Het
Gria1 T C 11: 57,317,802 probably null Het
Hdhd5 A G 6: 120,514,524 L206P probably damaging Het
Herc2 A G 7: 56,124,248 N1149S probably benign Het
Inca1 G A 11: 70,695,982 probably benign Het
Iqch G A 9: 63,547,990 S175F probably damaging Het
Itpr3 T G 17: 27,110,862 D1543E probably benign Het
Khk T A 5: 30,930,875 probably null Het
Kiz C T 2: 146,889,601 S337L probably damaging Het
Lzts3 G A 2: 130,636,539 T213I probably damaging Het
Mab21l2 T A 3: 86,546,718 D325V probably damaging Het
Mctp2 A G 7: 72,214,108 S336P probably benign Het
Me3 T A 7: 89,848,006 L405Q probably benign Het
Mgst2 A T 3: 51,661,230 probably benign Het
Myh2 A G 11: 67,192,504 E1431G probably damaging Het
Naip6 A G 13: 100,299,673 S781P probably damaging Het
Nr3c2 A G 8: 76,908,268 probably null Het
Olfr509 A T 7: 108,645,739 L279Q probably damaging Het
Olfr750 A G 14: 51,070,992 Y134H probably damaging Het
Olfr986 C T 9: 40,187,571 T152I probably benign Het
Otop1 G T 5: 38,277,822 R132L possibly damaging Het
Parg T A 14: 32,217,662 D548E possibly damaging Het
Pcdhga4 G T 18: 37,687,686 G763W probably benign Het
Pde10a A G 17: 8,949,372 N9S possibly damaging Het
Pi4k2a T C 19: 42,100,641 I147T probably benign Het
Polh T A 17: 46,194,325 T122S probably damaging Het
Ptpn13 T C 5: 103,477,118 V96A possibly damaging Het
Ptpn6 C A 6: 124,728,785 C132F probably damaging Het
Rbm19 T A 5: 120,132,867 V585E probably damaging Het
Rp1l1 C T 14: 64,028,906 P647L probably benign Het
Rrp1b A G 17: 32,047,675 E72G probably damaging Het
Shcbp1 A T 8: 4,748,742 H392Q probably benign Het
Skiv2l C T 17: 34,846,117 R371Q possibly damaging Het
Slc13a5 G A 11: 72,253,391 T287I possibly damaging Het
Slc22a27 T A 19: 7,926,757 E5V probably benign Het
Slc38a2 A G 15: 96,692,584 V293A probably damaging Het
Slco6d1 T A 1: 98,463,836 probably benign Het
Sri G C 5: 8,059,353 D46H probably damaging Het
Tango6 A G 8: 106,689,168 D207G possibly damaging Het
Tigd4 T C 3: 84,594,442 M222T probably benign Het
Tmem229a T C 6: 24,955,173 D194G probably benign Het
Trank1 T C 9: 111,366,685 V1259A possibly damaging Het
Trdv5 T C 14: 54,148,798 D70G probably benign Het
Trim52 T A 14: 106,106,941 M11K probably damaging Het
Wdr62 A G 7: 30,241,347 M882T probably benign Het
Ybx3 A G 6: 131,367,763 probably null Het
Zfand2b A G 1: 75,170,510 probably benign Het
Zfp91 T A 19: 12,770,320 T480S possibly damaging Het
Other mutations in Afap1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Afap1l2 APN 19 57002308 splice site probably benign
IGL01012:Afap1l2 APN 19 56930261 missense probably damaging 0.98
IGL01089:Afap1l2 APN 19 56913411 splice site probably null
IGL01150:Afap1l2 APN 19 56930186 missense probably damaging 0.99
IGL02393:Afap1l2 APN 19 56914440 missense probably damaging 1.00
IGL02887:Afap1l2 APN 19 56920563 missense probably damaging 1.00
IGL03060:Afap1l2 APN 19 56914250 nonsense probably null
R0102:Afap1l2 UTSW 19 56928440 unclassified probably benign
R0102:Afap1l2 UTSW 19 56928440 unclassified probably benign
R0282:Afap1l2 UTSW 19 56916221 missense possibly damaging 0.65
R0388:Afap1l2 UTSW 19 56917242 splice site probably benign
R0432:Afap1l2 UTSW 19 56917119 splice site probably benign
R0497:Afap1l2 UTSW 19 56930209 missense probably benign 0.27
R0578:Afap1l2 UTSW 19 56915782 missense probably benign 0.04
R0631:Afap1l2 UTSW 19 56916085 missense probably benign 0.39
R0670:Afap1l2 UTSW 19 56915803 missense probably damaging 1.00
R1188:Afap1l2 UTSW 19 56925069 missense probably damaging 0.97
R1236:Afap1l2 UTSW 19 56916472 missense possibly damaging 0.64
R1274:Afap1l2 UTSW 19 56914563 missense probably benign 0.02
R1463:Afap1l2 UTSW 19 56930151 missense probably benign 0.01
R1497:Afap1l2 UTSW 19 56928311 missense probably benign 0.25
R1597:Afap1l2 UTSW 19 56914449 missense probably benign 0.14
R1778:Afap1l2 UTSW 19 56916206 missense possibly damaging 0.68
R1795:Afap1l2 UTSW 19 56928409 missense probably damaging 1.00
R1991:Afap1l2 UTSW 19 57002267 missense possibly damaging 0.62
R2113:Afap1l2 UTSW 19 56913389 missense possibly damaging 0.95
R2242:Afap1l2 UTSW 19 56914468 missense possibly damaging 0.56
R3429:Afap1l2 UTSW 19 56915806 missense probably damaging 1.00
R3430:Afap1l2 UTSW 19 56915806 missense probably damaging 1.00
R3698:Afap1l2 UTSW 19 56916523 missense possibly damaging 0.69
R4706:Afap1l2 UTSW 19 56937240 missense possibly damaging 0.76
R4956:Afap1l2 UTSW 19 56943447 missense probably benign 0.00
R4993:Afap1l2 UTSW 19 56918040 missense probably damaging 1.00
R5772:Afap1l2 UTSW 19 56922974 missense probably benign 0.02
R6194:Afap1l2 UTSW 19 56922951 missense probably damaging 1.00
R6226:Afap1l2 UTSW 19 56916128 missense probably benign 0.00
R6334:Afap1l2 UTSW 19 56917976 unclassified probably null
R6439:Afap1l2 UTSW 19 56928386 missense possibly damaging 0.91
R7332:Afap1l2 UTSW 19 56918121 missense probably damaging 1.00
R7524:Afap1l2 UTSW 19 56918111 missense probably damaging 1.00
R7577:Afap1l2 UTSW 19 56944767 missense probably damaging 1.00
R7696:Afap1l2 UTSW 19 56914486 missense probably damaging 1.00
X0062:Afap1l2 UTSW 19 56918033 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACAACCTAAGTACCTGCTGG -3'
(R):5'- ACACAAGCCGGTTCCTTCTC -3'

Sequencing Primer
(F):5'- TGTTTCATGGATCCAGGCAGAGAC -3'
(R):5'- CTCTGGTCTGTAGAGATCAAACTTG -3'
Posted On2017-02-10