Incidental Mutation 'R5879:Zbtb18'
ID455693
Institutional Source Beutler Lab
Gene Symbol Zbtb18
Ensembl Gene ENSMUSG00000063659
Gene Namezinc finger and BTB domain containing 18
SynonymsRP58, Zfp238
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5879 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location177442351-177450764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 177448370 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 423 (Y423C)
Ref Sequence ENSEMBL: ENSMUSP00000141724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077225] [ENSMUST00000094276] [ENSMUST00000192699] [ENSMUST00000192851] [ENSMUST00000193440] [ENSMUST00000193480] [ENSMUST00000194319] [ENSMUST00000195002] [ENSMUST00000195388] [ENSMUST00000195549] [ENSMUST00000195612]
Predicted Effect probably damaging
Transcript: ENSMUST00000077225
AA Change: Y423C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076463
Gene: ENSMUSG00000063659
AA Change: Y423C

DomainStartEndE-ValueType
BTB 24 121 2.55e-22 SMART
ZnF_C2H2 370 392 1.28e-3 SMART
ZnF_C2H2 410 432 1.01e-1 SMART
ZnF_C2H2 438 460 9.58e-3 SMART
ZnF_C2H2 466 489 1.18e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094276
AA Change: Y432C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091831
Gene: ENSMUSG00000063659
AA Change: Y432C

DomainStartEndE-ValueType
BTB 33 130 2.55e-22 SMART
ZnF_C2H2 379 401 1.28e-3 SMART
ZnF_C2H2 419 441 1.01e-1 SMART
ZnF_C2H2 447 469 9.58e-3 SMART
ZnF_C2H2 475 498 1.18e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192699
Predicted Effect probably benign
Transcript: ENSMUST00000192851
SMART Domains Protein: ENSMUSP00000142256
Gene: ENSMUSG00000063659

DomainStartEndE-ValueType
BTB 24 121 1.6e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193440
SMART Domains Protein: ENSMUSP00000141337
Gene: ENSMUSG00000063659

DomainStartEndE-ValueType
BTB 24 121 1.6e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193480
SMART Domains Protein: ENSMUSP00000141663
Gene: ENSMUSG00000063659

DomainStartEndE-ValueType
BTB 33 130 1.6e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194269
Predicted Effect probably benign
Transcript: ENSMUST00000194319
Predicted Effect probably benign
Transcript: ENSMUST00000195002
Predicted Effect probably benign
Transcript: ENSMUST00000195388
SMART Domains Protein: ENSMUSP00000141694
Gene: ENSMUSG00000063659

DomainStartEndE-ValueType
BTB 24 121 1.6e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195549
SMART Domains Protein: ENSMUSP00000142073
Gene: ENSMUSG00000063659

DomainStartEndE-ValueType
BTB 24 121 1.6e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000195612
AA Change: Y423C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141724
Gene: ENSMUSG00000063659
AA Change: Y423C

DomainStartEndE-ValueType
BTB 24 121 2.55e-22 SMART
ZnF_C2H2 370 392 1.28e-3 SMART
ZnF_C2H2 410 432 1.01e-1 SMART
ZnF_C2H2 438 460 9.58e-3 SMART
ZnF_C2H2 466 489 1.18e-2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2-type zinc finger protein which acts a transcriptional repressor of genes involved in neuronal development. The encoded protein recognizes a specific sequence motif and recruits components of chromatin to target genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, cortical and hippocampal hypoplasia and laminar disorganization, and abnormal neuron apoptosis and cell cycling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,874,658 L87P probably damaging Het
Aldh16a1 C T 7: 45,147,506 W66* probably null Het
Arhgap39 T C 15: 76,751,807 D76G probably damaging Het
Arhgef2 G A 3: 88,643,617 probably null Het
C1qtnf2 T C 11: 43,486,008 M99T probably damaging Het
Eml3 G A 19: 8,935,015 C392Y possibly damaging Het
Ephb4 C A 5: 137,360,416 P287Q probably benign Het
Fat4 G T 3: 38,887,336 R126L probably benign Het
Flt3 T C 5: 147,334,909 M858V probably damaging Het
Gm13083 A T 4: 143,617,591 Y487F possibly damaging Het
Gprin3 A C 6: 59,354,713 I203R probably benign Het
Insr G T 8: 3,198,173 Y457* probably null Het
Ipo13 G A 4: 117,903,203 T649I possibly damaging Het
Krba1 A G 6: 48,415,744 D818G possibly damaging Het
Llgl1 G A 11: 60,712,980 G1016R probably benign Het
Loxl4 A G 19: 42,607,627 V142A probably benign Het
Mthfd1 A G 12: 76,294,218 I464V probably benign Het
Mycs C A X: 5,468,077 K316N probably damaging Het
Ncor2 A G 5: 125,026,775 probably benign Het
Nlrc3 A G 16: 3,964,045 F516S probably damaging Het
Oacyl A G 18: 65,749,672 S540G probably damaging Het
Olfml2a A T 2: 38,960,230 T653S probably damaging Het
Olfr285 C T 15: 98,313,488 V21I probably benign Het
Pcnx2 A T 8: 125,773,946 N1468K probably damaging Het
Plbd1 A G 6: 136,634,505 I258T probably damaging Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prop1 C T 11: 50,953,326 V27M probably damaging Het
Rfx4 T G 10: 84,814,761 probably null Het
Rgs11 C T 17: 26,203,463 probably benign Het
Slc6a5 T A 7: 49,945,512 F541I probably damaging Het
Srgap3 A T 6: 112,722,846 V1057E possibly damaging Het
Synpo2 A T 3: 123,114,297 W457R probably damaging Het
Tet2 T A 3: 133,487,960 N238Y possibly damaging Het
Tiam2 T A 17: 3,437,265 M687K probably damaging Het
Ticrr A G 7: 79,696,690 E1866G probably benign Het
Tspan8 T C 10: 115,833,251 S64P possibly damaging Het
Ugt2b37 C T 5: 87,254,406 G122D probably benign Het
Uqcrc2 A G 7: 120,637,888 E53G probably damaging Het
Vcan T C 13: 89,703,952 D963G probably damaging Het
Vmn2r24 T A 6: 123,787,267 Y368N possibly damaging Het
Wdr5 A G 2: 27,528,311 T208A probably benign Het
Zc3h6 A G 2: 128,997,776 probably null Het
Other mutations in Zbtb18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Zbtb18 APN 1 177447983 missense probably benign 0.01
IGL01967:Zbtb18 APN 1 177447782 missense probably benign 0.25
PIT4434001:Zbtb18 UTSW 1 177448423 missense possibly damaging 0.93
R0085:Zbtb18 UTSW 1 177447935 missense probably benign 0.00
R0119:Zbtb18 UTSW 1 177448157 missense probably benign 0.05
R0309:Zbtb18 UTSW 1 177448616 missense probably damaging 0.99
R1614:Zbtb18 UTSW 1 177447170 missense probably damaging 1.00
R1660:Zbtb18 UTSW 1 177447763 missense probably benign 0.05
R1676:Zbtb18 UTSW 1 177447347 unclassified probably null
R1750:Zbtb18 UTSW 1 177447511 missense possibly damaging 0.95
R2365:Zbtb18 UTSW 1 177448157 missense probably benign 0.05
R4282:Zbtb18 UTSW 1 177447479 missense probably damaging 1.00
R4497:Zbtb18 UTSW 1 177447121 missense probably damaging 1.00
R4542:Zbtb18 UTSW 1 177448666 missense probably damaging 0.99
R4678:Zbtb18 UTSW 1 177447719 missense probably benign 0.04
R5450:Zbtb18 UTSW 1 177447205 missense probably damaging 1.00
R5726:Zbtb18 UTSW 1 177448553 missense probably damaging 1.00
R5828:Zbtb18 UTSW 1 177447880 missense probably damaging 0.98
R6379:Zbtb18 UTSW 1 177447575 missense probably damaging 0.99
R6641:Zbtb18 UTSW 1 177448043 missense probably damaging 0.98
R7088:Zbtb18 UTSW 1 177447254 missense probably damaging 1.00
R7779:Zbtb18 UTSW 1 177446939 intron probably benign
Z1177:Zbtb18 UTSW 1 177447815 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGGCCAGATCTTCATGTGC -3'
(R):5'- TTGACCGACAAGGAGTTCACC -3'

Sequencing Primer
(F):5'- GTGCCCCCTGTGCAACAAAG -3'
(R):5'- ACTCACAGTGGAACTTGCG -3'
Posted On2017-02-10