Incidental Mutation 'R5879:Wdr5'
ID455695
Institutional Source Beutler Lab
Gene Symbol Wdr5
Ensembl Gene ENSMUSG00000026917
Gene NameWD repeat domain 5
SynonymsBmp2-induced gene, 2410008O07Rik, Big-3
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R5879 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location27515157-27536535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27528311 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 208 (T208A)
Ref Sequence ENSEMBL: ENSMUSP00000109585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113952]
PDB Structure
WDR5 IN COMPLEX WITH AN RBBP5 PEPTIDE RECRUITED TO NOVEL SITE [X-RAY DIFFRACTION]
WDR5 IN COMPLEX WITH AN RBBP5 PEPTIDE AND HISTONE H3 PEPTIDE [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000113952
AA Change: T208A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000109585
Gene: ENSMUSG00000026917
AA Change: T208A

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
WD40 34 73 4.11e-10 SMART
WD40 76 115 1.69e-11 SMART
WD40 118 157 9.22e-13 SMART
WD40 160 199 1.84e-12 SMART
WD40 202 242 7.33e-7 SMART
WD40 245 287 1.17e-5 SMART
WD40 290 331 3.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125088
Predicted Effect unknown
Transcript: ENSMUST00000140396
AA Change: T138A
SMART Domains Protein: ENSMUSP00000121654
Gene: ENSMUSG00000026917
AA Change: T138A

DomainStartEndE-ValueType
WD40 7 46 1.69e-11 SMART
WD40 49 88 9.22e-13 SMART
WD40 91 130 1.84e-12 SMART
WD40 133 189 1.33e-4 SMART
WD40 192 234 1.17e-5 SMART
WD40 237 278 3.27e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 7 WD repeats. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,874,658 L87P probably damaging Het
Aldh16a1 C T 7: 45,147,506 W66* probably null Het
Arhgap39 T C 15: 76,751,807 D76G probably damaging Het
Arhgef2 G A 3: 88,643,617 probably null Het
C1qtnf2 T C 11: 43,486,008 M99T probably damaging Het
Eml3 G A 19: 8,935,015 C392Y possibly damaging Het
Ephb4 C A 5: 137,360,416 P287Q probably benign Het
Fat4 G T 3: 38,887,336 R126L probably benign Het
Flt3 T C 5: 147,334,909 M858V probably damaging Het
Gm13083 A T 4: 143,617,591 Y487F possibly damaging Het
Gprin3 A C 6: 59,354,713 I203R probably benign Het
Insr G T 8: 3,198,173 Y457* probably null Het
Ipo13 G A 4: 117,903,203 T649I possibly damaging Het
Krba1 A G 6: 48,415,744 D818G possibly damaging Het
Llgl1 G A 11: 60,712,980 G1016R probably benign Het
Loxl4 A G 19: 42,607,627 V142A probably benign Het
Mthfd1 A G 12: 76,294,218 I464V probably benign Het
Mycs C A X: 5,468,077 K316N probably damaging Het
Ncor2 A G 5: 125,026,775 probably benign Het
Nlrc3 A G 16: 3,964,045 F516S probably damaging Het
Oacyl A G 18: 65,749,672 S540G probably damaging Het
Olfml2a A T 2: 38,960,230 T653S probably damaging Het
Olfr285 C T 15: 98,313,488 V21I probably benign Het
Pcnx2 A T 8: 125,773,946 N1468K probably damaging Het
Plbd1 A G 6: 136,634,505 I258T probably damaging Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prop1 C T 11: 50,953,326 V27M probably damaging Het
Rfx4 T G 10: 84,814,761 probably null Het
Rgs11 C T 17: 26,203,463 probably benign Het
Slc6a5 T A 7: 49,945,512 F541I probably damaging Het
Srgap3 A T 6: 112,722,846 V1057E possibly damaging Het
Synpo2 A T 3: 123,114,297 W457R probably damaging Het
Tet2 T A 3: 133,487,960 N238Y possibly damaging Het
Tiam2 T A 17: 3,437,265 M687K probably damaging Het
Ticrr A G 7: 79,696,690 E1866G probably benign Het
Tspan8 T C 10: 115,833,251 S64P possibly damaging Het
Ugt2b37 C T 5: 87,254,406 G122D probably benign Het
Uqcrc2 A G 7: 120,637,888 E53G probably damaging Het
Vcan T C 13: 89,703,952 D963G probably damaging Het
Vmn2r24 T A 6: 123,787,267 Y368N possibly damaging Het
Zbtb18 A G 1: 177,448,370 Y423C probably damaging Het
Zc3h6 A G 2: 128,997,776 probably null Het
Other mutations in Wdr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Wdr5 APN 2 27520867 missense probably benign 0.00
IGL01478:Wdr5 APN 2 27533832 missense probably damaging 1.00
IGL02690:Wdr5 APN 2 27534828 missense probably benign 0.08
IGL02742:Wdr5 APN 2 27520425 splice site probably benign
IGL03059:Wdr5 APN 2 27519734 unclassified probably benign
R0241:Wdr5 UTSW 2 27533013 missense probably damaging 1.00
R0630:Wdr5 UTSW 2 27520607 missense probably benign 0.05
R0738:Wdr5 UTSW 2 27519412 missense probably damaging 1.00
R1329:Wdr5 UTSW 2 27531671 missense probably damaging 1.00
R4130:Wdr5 UTSW 2 27520429 splice site probably benign
R5488:Wdr5 UTSW 2 27525153 missense probably damaging 1.00
R5859:Wdr5 UTSW 2 27533350 missense probably damaging 1.00
R6775:Wdr5 UTSW 2 27533374 missense probably damaging 1.00
R7583:Wdr5 UTSW 2 27518775 missense probably benign 0.00
R7849:Wdr5 UTSW 2 27519451 missense probably damaging 1.00
R7932:Wdr5 UTSW 2 27519451 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGTCTACCCATGTGTGCAC -3'
(R):5'- TCTGGTAAACGTTCGTAGTCAG -3'

Sequencing Primer
(F):5'- GTGTGCACATGATATTCTCACTCAG -3'
(R):5'- TTCGTAGTCAGGAAGAAAGGTGCC -3'
Posted On2017-02-10