Incidental Mutation 'R5879:Olfml2a'
ID455696
Institutional Source Beutler Lab
Gene Symbol Olfml2a
Ensembl Gene ENSMUSG00000046618
Gene Nameolfactomedin-like 2A
Synonymsphotomedin-1, 4932431K08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R5879 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location38931978-38963753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38960230 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 653 (T653S)
Ref Sequence ENSEMBL: ENSMUSP00000058761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057279]
Predicted Effect probably damaging
Transcript: ENSMUST00000057279
AA Change: T653S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058761
Gene: ENSMUSG00000046618
AA Change: T653S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
internal_repeat_1 39 66 2.55e-7 PROSPERO
internal_repeat_1 78 105 2.55e-7 PROSPERO
coiled coil region 168 189 N/A INTRINSIC
low complexity region 212 228 N/A INTRINSIC
low complexity region 252 271 N/A INTRINSIC
low complexity region 302 320 N/A INTRINSIC
low complexity region 367 407 N/A INTRINSIC
OLF 426 681 8.73e-69 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,874,658 L87P probably damaging Het
Aldh16a1 C T 7: 45,147,506 W66* probably null Het
Arhgap39 T C 15: 76,751,807 D76G probably damaging Het
Arhgef2 G A 3: 88,643,617 probably null Het
C1qtnf2 T C 11: 43,486,008 M99T probably damaging Het
Eml3 G A 19: 8,935,015 C392Y possibly damaging Het
Ephb4 C A 5: 137,360,416 P287Q probably benign Het
Fat4 G T 3: 38,887,336 R126L probably benign Het
Flt3 T C 5: 147,334,909 M858V probably damaging Het
Gm13083 A T 4: 143,617,591 Y487F possibly damaging Het
Gprin3 A C 6: 59,354,713 I203R probably benign Het
Insr G T 8: 3,198,173 Y457* probably null Het
Ipo13 G A 4: 117,903,203 T649I possibly damaging Het
Krba1 A G 6: 48,415,744 D818G possibly damaging Het
Llgl1 G A 11: 60,712,980 G1016R probably benign Het
Loxl4 A G 19: 42,607,627 V142A probably benign Het
Mthfd1 A G 12: 76,294,218 I464V probably benign Het
Mycs C A X: 5,468,077 K316N probably damaging Het
Ncor2 A G 5: 125,026,775 probably benign Het
Nlrc3 A G 16: 3,964,045 F516S probably damaging Het
Oacyl A G 18: 65,749,672 S540G probably damaging Het
Olfr285 C T 15: 98,313,488 V21I probably benign Het
Pcnx2 A T 8: 125,773,946 N1468K probably damaging Het
Plbd1 A G 6: 136,634,505 I258T probably damaging Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prop1 C T 11: 50,953,326 V27M probably damaging Het
Rfx4 T G 10: 84,814,761 probably null Het
Rgs11 C T 17: 26,203,463 probably benign Het
Slc6a5 T A 7: 49,945,512 F541I probably damaging Het
Srgap3 A T 6: 112,722,846 V1057E possibly damaging Het
Synpo2 A T 3: 123,114,297 W457R probably damaging Het
Tet2 T A 3: 133,487,960 N238Y possibly damaging Het
Tiam2 T A 17: 3,437,265 M687K probably damaging Het
Ticrr A G 7: 79,696,690 E1866G probably benign Het
Tspan8 T C 10: 115,833,251 S64P possibly damaging Het
Ugt2b37 C T 5: 87,254,406 G122D probably benign Het
Uqcrc2 A G 7: 120,637,888 E53G probably damaging Het
Vcan T C 13: 89,703,952 D963G probably damaging Het
Vmn2r24 T A 6: 123,787,267 Y368N possibly damaging Het
Wdr5 A G 2: 27,528,311 T208A probably benign Het
Zbtb18 A G 1: 177,448,370 Y423C probably damaging Het
Zc3h6 A G 2: 128,997,776 probably null Het
Other mutations in Olfml2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Olfml2a APN 2 38947214 critical splice acceptor site probably null
IGL02367:Olfml2a APN 2 38954668 missense probably benign 0.15
IGL03140:Olfml2a APN 2 38947291 missense probably damaging 1.00
R0559:Olfml2a UTSW 2 38959820 missense probably damaging 1.00
R0781:Olfml2a UTSW 2 38959753 missense probably damaging 0.99
R1110:Olfml2a UTSW 2 38959753 missense probably damaging 0.99
R1187:Olfml2a UTSW 2 38959813 missense probably damaging 1.00
R1626:Olfml2a UTSW 2 38951263 missense probably damaging 1.00
R1634:Olfml2a UTSW 2 38960219 missense probably benign 0.03
R2127:Olfml2a UTSW 2 38941687 missense probably damaging 1.00
R2987:Olfml2a UTSW 2 38947294 missense probably damaging 0.97
R4428:Olfml2a UTSW 2 38941743 missense probably damaging 0.96
R4564:Olfml2a UTSW 2 38960294 missense probably benign 0.40
R4609:Olfml2a UTSW 2 38957721 missense probably damaging 0.98
R4667:Olfml2a UTSW 2 38949010 missense probably damaging 0.99
R4703:Olfml2a UTSW 2 38951238 missense probably damaging 1.00
R4827:Olfml2a UTSW 2 38960021 missense probably damaging 1.00
R5588:Olfml2a UTSW 2 38960035 missense probably damaging 1.00
R6063:Olfml2a UTSW 2 38951143 missense probably benign 0.03
R6484:Olfml2a UTSW 2 38959768 missense probably damaging 1.00
R6788:Olfml2a UTSW 2 38960226 nonsense probably null
R7345:Olfml2a UTSW 2 38960127 missense probably damaging 1.00
R7474:Olfml2a UTSW 2 38960261 missense probably damaging 0.98
R8073:Olfml2a UTSW 2 38957754 missense probably damaging 1.00
Z1177:Olfml2a UTSW 2 38960284 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- ACACAGCATGAGGTGATTGTG -3'
(R):5'- TACTGGGCACTGAGAAAGCAC -3'

Sequencing Primer
(F):5'- AGCAGACCTCTCTGTGCAC -3'
(R):5'- GGCACTGAGAAAGCACTCAAAGC -3'
Posted On2017-02-10