Incidental Mutation 'R5879:Tet2'
ID455702
Institutional Source Beutler Lab
Gene Symbol Tet2
Ensembl Gene ENSMUSG00000040943
Gene Nametet methylcytosine dioxygenase 2
SynonymsE130014J05Rik, Ayu17-449
Accession Numbers

Ncbi RefSeq: NM_001040400.2; MGI:2443298

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5879 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location133463679-133545139 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 133487960 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 238 (N238Y)
Ref Sequence ENSEMBL: ENSMUSP00000143029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098603] [ENSMUST00000196398] [ENSMUST00000197118]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098603
AA Change: N238Y

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096203
Gene: ENSMUSG00000040943
AA Change: N238Y

DomainStartEndE-ValueType
low complexity region 690 701 N/A INTRINSIC
low complexity region 855 862 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 899 921 N/A INTRINSIC
Tet_JBP 1203 1819 7e-301 SMART
low complexity region 1832 1844 N/A INTRINSIC
low complexity region 1885 1897 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196398
AA Change: N238Y

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143029
Gene: ENSMUSG00000040943
AA Change: N238Y

DomainStartEndE-ValueType
low complexity region 690 701 N/A INTRINSIC
low complexity region 855 862 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 899 921 N/A INTRINSIC
Tet_JBP 1211 1827 3.4e-305 SMART
low complexity region 1840 1852 N/A INTRINSIC
low complexity region 1893 1905 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197118
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype Strain: 5285413; 4345275; 3813933; 5301343
Lethality: D1-D2
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a methylcytosine dioxygenase that catalyzes the conversion of methylcytosine to 5-hydroxymethylcytosine. The encoded protein is involved in myelopoiesis, and defects in this gene have been associated with several myeloproliferative disorders. Two variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele die shortly after birth and exhibit a loss of acidic granules in the proximal convoluted tubules of the kidneys. Mice homozygous for a conditional allele activated in hematopoeitic compartment exhibit self-renewal and myeloid transforamtion. [provided by MGI curators]
Allele List at MGI

All alleles(1246) : Targeted(6) Gene trapped(1240)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,874,658 L87P probably damaging Het
Aldh16a1 C T 7: 45,147,506 W66* probably null Het
Arhgap39 T C 15: 76,751,807 D76G probably damaging Het
Arhgef2 G A 3: 88,643,617 probably null Het
C1qtnf2 T C 11: 43,486,008 M99T probably damaging Het
Eml3 G A 19: 8,935,015 C392Y possibly damaging Het
Ephb4 C A 5: 137,360,416 P287Q probably benign Het
Fat4 G T 3: 38,887,336 R126L probably benign Het
Flt3 T C 5: 147,334,909 M858V probably damaging Het
Gm13083 A T 4: 143,617,591 Y487F possibly damaging Het
Gprin3 A C 6: 59,354,713 I203R probably benign Het
Insr G T 8: 3,198,173 Y457* probably null Het
Ipo13 G A 4: 117,903,203 T649I possibly damaging Het
Krba1 A G 6: 48,415,744 D818G possibly damaging Het
Llgl1 G A 11: 60,712,980 G1016R probably benign Het
Loxl4 A G 19: 42,607,627 V142A probably benign Het
Mthfd1 A G 12: 76,294,218 I464V probably benign Het
Mycs C A X: 5,468,077 K316N probably damaging Het
Ncor2 A G 5: 125,026,775 probably benign Het
Nlrc3 A G 16: 3,964,045 F516S probably damaging Het
Oacyl A G 18: 65,749,672 S540G probably damaging Het
Olfml2a A T 2: 38,960,230 T653S probably damaging Het
Olfr285 C T 15: 98,313,488 V21I probably benign Het
Pcnx2 A T 8: 125,773,946 N1468K probably damaging Het
Plbd1 A G 6: 136,634,505 I258T probably damaging Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prop1 C T 11: 50,953,326 V27M probably damaging Het
Rfx4 T G 10: 84,814,761 probably null Het
Rgs11 C T 17: 26,203,463 probably benign Het
Slc6a5 T A 7: 49,945,512 F541I probably damaging Het
Srgap3 A T 6: 112,722,846 V1057E possibly damaging Het
Synpo2 A T 3: 123,114,297 W457R probably damaging Het
Tiam2 T A 17: 3,437,265 M687K probably damaging Het
Ticrr A G 7: 79,696,690 E1866G probably benign Het
Tspan8 T C 10: 115,833,251 S64P possibly damaging Het
Ugt2b37 C T 5: 87,254,406 G122D probably benign Het
Uqcrc2 A G 7: 120,637,888 E53G probably damaging Het
Vcan T C 13: 89,703,952 D963G probably damaging Het
Vmn2r24 T A 6: 123,787,267 Y368N possibly damaging Het
Wdr5 A G 2: 27,528,311 T208A probably benign Het
Zbtb18 A G 1: 177,448,370 Y423C probably damaging Het
Zc3h6 A G 2: 128,997,776 probably null Het
Other mutations in Tet2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Tet2 APN 3 133488085 missense possibly damaging 0.96
IGL00401:Tet2 APN 3 133466882 missense possibly damaging 0.72
IGL01528:Tet2 APN 3 133480298 missense possibly damaging 0.86
IGL02053:Tet2 APN 3 133488523 missense possibly damaging 0.96
IGL02142:Tet2 APN 3 133480139 missense possibly damaging 0.96
IGL02512:Tet2 APN 3 133469308 missense probably benign 0.05
IGL03148:Tet2 APN 3 133481363 missense probably benign 0.18
IGL03182:Tet2 APN 3 133471398 nonsense probably null
IGL03371:Tet2 APN 3 133467551 missense possibly damaging 0.71
P0022:Tet2 UTSW 3 133486893 missense probably benign 0.01
P0023:Tet2 UTSW 3 133486893 missense probably benign 0.01
P0031:Tet2 UTSW 3 133480202 missense possibly damaging 0.53
R0012:Tet2 UTSW 3 133476558 missense probably damaging 0.98
R0012:Tet2 UTSW 3 133476558 missense probably damaging 0.98
R0463:Tet2 UTSW 3 133486666 missense possibly damaging 0.86
R0522:Tet2 UTSW 3 133466804 missense probably damaging 0.98
R0593:Tet2 UTSW 3 133488109 missense probably benign 0.00
R0600:Tet2 UTSW 3 133467602 missense probably benign 0.00
R0600:Tet2 UTSW 3 133467725 missense probably benign 0.01
R0698:Tet2 UTSW 3 133467384 missense probably benign 0.32
R0723:Tet2 UTSW 3 133467284 missense probably benign
R0726:Tet2 UTSW 3 133468184 missense probably benign
R0747:Tet2 UTSW 3 133467470 missense possibly damaging 0.86
R1006:Tet2 UTSW 3 133476601 missense possibly damaging 0.53
R1382:Tet2 UTSW 3 133476615 missense probably damaging 1.00
R1455:Tet2 UTSW 3 133473645 missense possibly damaging 0.51
R1550:Tet2 UTSW 3 133469519 missense probably benign 0.32
R1647:Tet2 UTSW 3 133485880 missense probably benign
R1662:Tet2 UTSW 3 133466852 missense possibly damaging 0.96
R1727:Tet2 UTSW 3 133487290 missense probably damaging 0.98
R1738:Tet2 UTSW 3 133481387 missense probably benign 0.08
R1749:Tet2 UTSW 3 133480131 critical splice donor site probably null
R1869:Tet2 UTSW 3 133481441 splice site probably null
R1887:Tet2 UTSW 3 133487333 missense possibly damaging 0.68
R1937:Tet2 UTSW 3 133488638 missense possibly damaging 0.68
R1939:Tet2 UTSW 3 133488638 missense possibly damaging 0.68
R1940:Tet2 UTSW 3 133488638 missense possibly damaging 0.68
R1997:Tet2 UTSW 3 133486589 nonsense probably null
R2082:Tet2 UTSW 3 133485727 missense possibly damaging 0.96
R2084:Tet2 UTSW 3 133487767 missense possibly damaging 0.68
R2215:Tet2 UTSW 3 133486601 missense probably benign 0.03
R2321:Tet2 UTSW 3 133486339 missense possibly damaging 0.53
R2873:Tet2 UTSW 3 133486954 missense probably damaging 1.00
R3439:Tet2 UTSW 3 133466831 missense possibly damaging 0.93
R3783:Tet2 UTSW 3 133479363 missense possibly damaging 0.53
R3894:Tet2 UTSW 3 133469477 missense possibly damaging 0.86
R3916:Tet2 UTSW 3 133486055 missense possibly damaging 0.53
R3966:Tet2 UTSW 3 133487657 missense possibly damaging 0.73
R4457:Tet2 UTSW 3 133485563 missense possibly damaging 0.85
R4633:Tet2 UTSW 3 133485549 missense probably benign 0.33
R4646:Tet2 UTSW 3 133488082 missense probably benign 0.02
R4647:Tet2 UTSW 3 133488082 missense probably benign 0.02
R4648:Tet2 UTSW 3 133488082 missense probably benign 0.02
R4691:Tet2 UTSW 3 133486083 missense possibly damaging 0.73
R4805:Tet2 UTSW 3 133467315 missense probably benign 0.32
R4829:Tet2 UTSW 3 133476620 missense possibly damaging 0.91
R4901:Tet2 UTSW 3 133467044 missense possibly damaging 0.86
R4975:Tet2 UTSW 3 133486759 unclassified probably benign
R5004:Tet2 UTSW 3 133487379 missense possibly damaging 0.84
R5075:Tet2 UTSW 3 133486906 missense probably benign
R5137:Tet2 UTSW 3 133476565 missense probably benign 0.32
R5324:Tet2 UTSW 3 133485913 missense probably benign 0.00
R5590:Tet2 UTSW 3 133476480 splice site probably null
R5854:Tet2 UTSW 3 133487885 missense probably damaging 0.98
R5856:Tet2 UTSW 3 133486640 missense probably benign 0.01
R5865:Tet2 UTSW 3 133487099 missense probably benign 0.08
R5935:Tet2 UTSW 3 133488535 missense possibly damaging 0.68
R6012:Tet2 UTSW 3 133466781 missense possibly damaging 0.86
R6075:Tet2 UTSW 3 133471435 missense possibly damaging 0.71
R6181:Tet2 UTSW 3 133487759 nonsense probably null
R6188:Tet2 UTSW 3 133480326 missense probably benign 0.18
R6339:Tet2 UTSW 3 133486417 missense possibly damaging 0.53
R6612:Tet2 UTSW 3 133487335 missense possibly damaging 0.53
R6923:Tet2 UTSW 3 133479341 critical splice donor site probably null
R6934:Tet2 UTSW 3 133483237 critical splice donor site probably null
R7076:Tet2 UTSW 3 133467023 missense possibly damaging 0.71
R7155:Tet2 UTSW 3 133469591 missense possibly damaging 0.71
R7184:Tet2 UTSW 3 133473630 missense probably damaging 0.98
R7200:Tet2 UTSW 3 133487192 missense probably benign 0.18
R7459:Tet2 UTSW 3 133480289 missense possibly damaging 0.53
R7504:Tet2 UTSW 3 133487339 missense probably benign 0.33
R7524:Tet2 UTSW 3 133480229 missense probably benign 0.33
R7613:Tet2 UTSW 3 133466748 missense possibly damaging 0.83
R7653:Tet2 UTSW 3 133486385 missense probably benign 0.18
R7691:Tet2 UTSW 3 133486849 missense probably damaging 0.98
R7770:Tet2 UTSW 3 133480295 missense possibly damaging 0.53
R7807:Tet2 UTSW 3 133486541 missense possibly damaging 0.53
R7813:Tet2 UTSW 3 133473643 missense probably benign 0.06
R8055:Tet2 UTSW 3 133467992 missense possibly damaging 0.93
X0021:Tet2 UTSW 3 133486295 missense possibly damaging 0.85
X0066:Tet2 UTSW 3 133488373 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTGTTCTGCTTTCTGAAAAGGAC -3'
(R):5'- TCAGGTTCTCAACGAGCAGG -3'

Sequencing Primer
(F):5'- CTGCTTTCTGAAAAGGACAGGTACC -3'
(R):5'- TTCTCAACGAGCAGGAAGGG -3'
Posted On2017-02-10