Incidental Mutation 'R5879:Ugt2b37'
ID455705
Institutional Source Beutler Lab
Gene Symbol Ugt2b37
Ensembl Gene ENSMUSG00000057425
Gene NameUDP glucuronosyltransferase 2 family, polypeptide B37
Synonyms0610033E06Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5879 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location87240493-87254804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87254406 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 122 (G122D)
Ref Sequence ENSEMBL: ENSMUSP00000075255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075858]
Predicted Effect probably benign
Transcript: ENSMUST00000075858
AA Change: G122D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075255
Gene: ENSMUSG00000057425
AA Change: G122D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 527 5.5e-256 PFAM
Pfam:Glyco_tran_28_C 328 449 2.5e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,874,658 L87P probably damaging Het
Aldh16a1 C T 7: 45,147,506 W66* probably null Het
Arhgap39 T C 15: 76,751,807 D76G probably damaging Het
Arhgef2 G A 3: 88,643,617 probably null Het
C1qtnf2 T C 11: 43,486,008 M99T probably damaging Het
Eml3 G A 19: 8,935,015 C392Y possibly damaging Het
Ephb4 C A 5: 137,360,416 P287Q probably benign Het
Fat4 G T 3: 38,887,336 R126L probably benign Het
Flt3 T C 5: 147,334,909 M858V probably damaging Het
Gm13083 A T 4: 143,617,591 Y487F possibly damaging Het
Gprin3 A C 6: 59,354,713 I203R probably benign Het
Insr G T 8: 3,198,173 Y457* probably null Het
Ipo13 G A 4: 117,903,203 T649I possibly damaging Het
Krba1 A G 6: 48,415,744 D818G possibly damaging Het
Llgl1 G A 11: 60,712,980 G1016R probably benign Het
Loxl4 A G 19: 42,607,627 V142A probably benign Het
Mthfd1 A G 12: 76,294,218 I464V probably benign Het
Mycs C A X: 5,468,077 K316N probably damaging Het
Ncor2 A G 5: 125,026,775 probably benign Het
Nlrc3 A G 16: 3,964,045 F516S probably damaging Het
Oacyl A G 18: 65,749,672 S540G probably damaging Het
Olfml2a A T 2: 38,960,230 T653S probably damaging Het
Olfr285 C T 15: 98,313,488 V21I probably benign Het
Pcnx2 A T 8: 125,773,946 N1468K probably damaging Het
Plbd1 A G 6: 136,634,505 I258T probably damaging Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prop1 C T 11: 50,953,326 V27M probably damaging Het
Rfx4 T G 10: 84,814,761 probably null Het
Rgs11 C T 17: 26,203,463 probably benign Het
Slc6a5 T A 7: 49,945,512 F541I probably damaging Het
Srgap3 A T 6: 112,722,846 V1057E possibly damaging Het
Synpo2 A T 3: 123,114,297 W457R probably damaging Het
Tet2 T A 3: 133,487,960 N238Y possibly damaging Het
Tiam2 T A 17: 3,437,265 M687K probably damaging Het
Ticrr A G 7: 79,696,690 E1866G probably benign Het
Tspan8 T C 10: 115,833,251 S64P possibly damaging Het
Uqcrc2 A G 7: 120,637,888 E53G probably damaging Het
Vcan T C 13: 89,703,952 D963G probably damaging Het
Vmn2r24 T A 6: 123,787,267 Y368N possibly damaging Het
Wdr5 A G 2: 27,528,311 T208A probably benign Het
Zbtb18 A G 1: 177,448,370 Y423C probably damaging Het
Zc3h6 A G 2: 128,997,776 probably null Het
Other mutations in Ugt2b37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Ugt2b37 APN 5 87242481 missense possibly damaging 0.90
IGL00567:Ugt2b37 APN 5 87254074 missense probably damaging 1.00
IGL00787:Ugt2b37 APN 5 87242429 missense probably benign 0.00
IGL01560:Ugt2b37 APN 5 87251839 missense probably damaging 1.00
IGL01617:Ugt2b37 APN 5 87251879 missense probably damaging 1.00
IGL01982:Ugt2b37 APN 5 87242432 missense probably damaging 1.00
IGL02299:Ugt2b37 APN 5 87242315 missense probably benign 0.00
IGL02323:Ugt2b37 APN 5 87250564 splice site probably benign
IGL02326:Ugt2b37 APN 5 87241002 missense probably benign 0.25
IGL02516:Ugt2b37 APN 5 87240882 missense probably damaging 1.00
IGL03285:Ugt2b37 APN 5 87240875 missense probably damaging 1.00
R0076:Ugt2b37 UTSW 5 87254221 missense probably benign 0.31
R0141:Ugt2b37 UTSW 5 87240983 missense probably damaging 1.00
R0312:Ugt2b37 UTSW 5 87250665 missense probably damaging 1.00
R0359:Ugt2b37 UTSW 5 87250584 missense probably benign 0.10
R0523:Ugt2b37 UTSW 5 87251832 missense possibly damaging 0.91
R1938:Ugt2b37 UTSW 5 87240857 missense probably damaging 1.00
R1962:Ugt2b37 UTSW 5 87254334 missense probably damaging 1.00
R2496:Ugt2b37 UTSW 5 87254710 missense probably damaging 0.97
R3704:Ugt2b37 UTSW 5 87242987 missense possibly damaging 0.55
R4430:Ugt2b37 UTSW 5 87254092 missense probably benign 0.00
R4825:Ugt2b37 UTSW 5 87250639 missense possibly damaging 0.91
R5043:Ugt2b37 UTSW 5 87251860 nonsense probably null
R5098:Ugt2b37 UTSW 5 87242953 missense probably damaging 1.00
R5174:Ugt2b37 UTSW 5 87251880 missense probably benign 0.00
R5522:Ugt2b37 UTSW 5 87240900 missense probably benign 0.14
R5999:Ugt2b37 UTSW 5 87254177 missense probably benign 0.25
R6374:Ugt2b37 UTSW 5 87242420 missense probably damaging 1.00
R6454:Ugt2b37 UTSW 5 87240977 missense probably damaging 1.00
R6857:Ugt2b37 UTSW 5 87240846 missense probably damaging 0.98
R6875:Ugt2b37 UTSW 5 87242429 missense probably benign 0.00
R6916:Ugt2b37 UTSW 5 87254600 missense probably benign 0.07
R7099:Ugt2b37 UTSW 5 87240989 missense probably benign 0.00
R7239:Ugt2b37 UTSW 5 87254731 missense probably benign
R7470:Ugt2b37 UTSW 5 87254112 missense probably benign 0.24
R7810:Ugt2b37 UTSW 5 87254259 missense probably damaging 1.00
R7841:Ugt2b37 UTSW 5 87250630 missense probably benign 0.05
R7860:Ugt2b37 UTSW 5 87254330 missense probably damaging 1.00
R7861:Ugt2b37 UTSW 5 87242440 nonsense probably null
R7924:Ugt2b37 UTSW 5 87250630 missense probably benign 0.05
R7943:Ugt2b37 UTSW 5 87254330 missense probably damaging 1.00
R7944:Ugt2b37 UTSW 5 87242440 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCTGTAACCTGCAGTGAAGC -3'
(R):5'- TACAGAGGGGCCATGAAGTCAC -3'

Sequencing Primer
(F):5'- CTGCAGTGAAGCGAAGACTGTAC -3'
(R):5'- GCCATGAAGTCACTGTTCTGAGAC -3'
Posted On2017-02-10