Incidental Mutation 'R5879:Ephb4'
ID455707
Institutional Source Beutler Lab
Gene Symbol Ephb4
Ensembl Gene ENSMUSG00000029710
Gene NameEph receptor B4
SynonymsMDK2, Htk, Myk1, Tyro11
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5879 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location137350109-137378669 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 137360416 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 287 (P287Q)
Ref Sequence ENSEMBL: ENSMUSP00000130275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061244] [ENSMUST00000111054] [ENSMUST00000111055] [ENSMUST00000144296] [ENSMUST00000166239]
Predicted Effect probably benign
Transcript: ENSMUST00000061244
AA Change: P287Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000051622
Gene: ENSMUSG00000029710
AA Change: P287Q

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111054
AA Change: P287Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106683
Gene: ENSMUSG00000029710
AA Change: P287Q

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 1.4e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 3.4e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
Pfam:SAM_1 882 917 2.6e-7 PFAM
low complexity region 919 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111055
AA Change: P287Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106684
Gene: ENSMUSG00000029710
AA Change: P287Q

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 4.2e-10 PFAM
FN3 324 413 1.75e-6 SMART
FN3 443 525 1.07e-10 SMART
Pfam:EphA2_TM 550 621 5e-24 PFAM
TyrKc 624 883 5.09e-130 SMART
SAM 913 980 2.44e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144296
AA Change: P287Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000115731
Gene: ENSMUSG00000029710
AA Change: P287Q

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166239
AA Change: P287Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000130275
Gene: ENSMUSG00000029710
AA Change: P287Q

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit arrested angiogenesis and heart development and midgestational lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,874,658 L87P probably damaging Het
Aldh16a1 C T 7: 45,147,506 W66* probably null Het
Arhgap39 T C 15: 76,751,807 D76G probably damaging Het
Arhgef2 G A 3: 88,643,617 probably null Het
C1qtnf2 T C 11: 43,486,008 M99T probably damaging Het
Eml3 G A 19: 8,935,015 C392Y possibly damaging Het
Fat4 G T 3: 38,887,336 R126L probably benign Het
Flt3 T C 5: 147,334,909 M858V probably damaging Het
Gm13083 A T 4: 143,617,591 Y487F possibly damaging Het
Gprin3 A C 6: 59,354,713 I203R probably benign Het
Insr G T 8: 3,198,173 Y457* probably null Het
Ipo13 G A 4: 117,903,203 T649I possibly damaging Het
Krba1 A G 6: 48,415,744 D818G possibly damaging Het
Llgl1 G A 11: 60,712,980 G1016R probably benign Het
Loxl4 A G 19: 42,607,627 V142A probably benign Het
Mthfd1 A G 12: 76,294,218 I464V probably benign Het
Mycs C A X: 5,468,077 K316N probably damaging Het
Ncor2 A G 5: 125,026,775 probably benign Het
Nlrc3 A G 16: 3,964,045 F516S probably damaging Het
Oacyl A G 18: 65,749,672 S540G probably damaging Het
Olfml2a A T 2: 38,960,230 T653S probably damaging Het
Olfr285 C T 15: 98,313,488 V21I probably benign Het
Pcnx2 A T 8: 125,773,946 N1468K probably damaging Het
Plbd1 A G 6: 136,634,505 I258T probably damaging Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prop1 C T 11: 50,953,326 V27M probably damaging Het
Rfx4 T G 10: 84,814,761 probably null Het
Rgs11 C T 17: 26,203,463 probably benign Het
Slc6a5 T A 7: 49,945,512 F541I probably damaging Het
Srgap3 A T 6: 112,722,846 V1057E possibly damaging Het
Synpo2 A T 3: 123,114,297 W457R probably damaging Het
Tet2 T A 3: 133,487,960 N238Y possibly damaging Het
Tiam2 T A 17: 3,437,265 M687K probably damaging Het
Ticrr A G 7: 79,696,690 E1866G probably benign Het
Tspan8 T C 10: 115,833,251 S64P possibly damaging Het
Ugt2b37 C T 5: 87,254,406 G122D probably benign Het
Uqcrc2 A G 7: 120,637,888 E53G probably damaging Het
Vcan T C 13: 89,703,952 D963G probably damaging Het
Vmn2r24 T A 6: 123,787,267 Y368N possibly damaging Het
Wdr5 A G 2: 27,528,311 T208A probably benign Het
Zbtb18 A G 1: 177,448,370 Y423C probably damaging Het
Zc3h6 A G 2: 128,997,776 probably null Het
Other mutations in Ephb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Ephb4 APN 5 137365615 splice site probably benign
IGL00948:Ephb4 APN 5 137366659 missense probably damaging 1.00
IGL01653:Ephb4 APN 5 137365741 splice site probably benign
IGL01885:Ephb4 APN 5 137357797 missense probably damaging 1.00
IGL01906:Ephb4 APN 5 137361194 missense probably damaging 1.00
IGL02089:Ephb4 APN 5 137370762 missense probably damaging 0.98
IGL02216:Ephb4 APN 5 137372070 missense possibly damaging 0.92
IGL02233:Ephb4 APN 5 137354501 nonsense probably null
IGL03080:Ephb4 APN 5 137354083 splice site probably benign
IGL03111:Ephb4 APN 5 137372505 missense probably benign 0.07
R0599:Ephb4 UTSW 5 137369855 missense probably damaging 1.00
R0744:Ephb4 UTSW 5 137365667 missense probably damaging 1.00
R1331:Ephb4 UTSW 5 137366534 splice site probably benign
R1441:Ephb4 UTSW 5 137361247 missense probably damaging 1.00
R1732:Ephb4 UTSW 5 137372178 missense possibly damaging 0.93
R1745:Ephb4 UTSW 5 137360434 missense probably benign
R1831:Ephb4 UTSW 5 137354415 missense probably damaging 1.00
R1865:Ephb4 UTSW 5 137363310 missense possibly damaging 0.53
R2165:Ephb4 UTSW 5 137354426 missense probably benign 0.08
R2206:Ephb4 UTSW 5 137357719 missense probably damaging 1.00
R2473:Ephb4 UTSW 5 137365700 missense probably benign 0.15
R4779:Ephb4 UTSW 5 137365702 missense probably benign 0.04
R4801:Ephb4 UTSW 5 137365506 missense probably damaging 1.00
R4802:Ephb4 UTSW 5 137365506 missense probably damaging 1.00
R5307:Ephb4 UTSW 5 137363312 missense probably damaging 1.00
R5452:Ephb4 UTSW 5 137361142 missense probably damaging 1.00
R5458:Ephb4 UTSW 5 137369852 missense probably damaging 1.00
R5475:Ephb4 UTSW 5 137354439 missense probably benign 0.00
R5662:Ephb4 UTSW 5 137372195 missense probably damaging 0.98
R6336:Ephb4 UTSW 5 137372085 missense probably damaging 1.00
R6443:Ephb4 UTSW 5 137360449 missense probably damaging 1.00
R6632:Ephb4 UTSW 5 137366587 missense probably damaging 0.99
R6973:Ephb4 UTSW 5 137369804 missense probably damaging 1.00
R7008:Ephb4 UTSW 5 137361274 missense probably benign 0.00
R7145:Ephb4 UTSW 5 137372046 missense probably damaging 1.00
R7421:Ephb4 UTSW 5 137354425 missense possibly damaging 0.88
R7593:Ephb4 UTSW 5 137361298 missense probably benign
R7635:Ephb4 UTSW 5 137372103 missense probably damaging 1.00
R7751:Ephb4 UTSW 5 137365675 missense probably damaging 1.00
R7825:Ephb4 UTSW 5 137372437 missense probably damaging 1.00
X0026:Ephb4 UTSW 5 137373558 missense probably damaging 1.00
Z1177:Ephb4 UTSW 5 137361359 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGCTCTGTCTGCATGCAGG -3'
(R):5'- CAGGAACCATATGGGGAGTC -3'

Sequencing Primer
(F):5'- ATGATGCTTGTAAGGCACCC -3'
(R):5'- TGGGGAGTCCACACACTC -3'
Posted On2017-02-10