Incidental Mutation 'R5879:Gprin3'
ID455711
Institutional Source Beutler Lab
Gene Symbol Gprin3
Ensembl Gene ENSMUSG00000045441
Gene NameGPRIN family member 3
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R5879 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location59347226-59426294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 59354713 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Arginine at position 203 (I203R)
Ref Sequence ENSEMBL: ENSMUSP00000051805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051065]
Predicted Effect probably benign
Transcript: ENSMUST00000051065
AA Change: I203R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051805
Gene: ENSMUSG00000045441
AA Change: I203R

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
low complexity region 311 329 N/A INTRINSIC
low complexity region 593 609 N/A INTRINSIC
Pfam:GRIN_C 627 758 2.7e-49 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,874,658 L87P probably damaging Het
Aldh16a1 C T 7: 45,147,506 W66* probably null Het
Arhgap39 T C 15: 76,751,807 D76G probably damaging Het
Arhgef2 G A 3: 88,643,617 probably null Het
C1qtnf2 T C 11: 43,486,008 M99T probably damaging Het
Eml3 G A 19: 8,935,015 C392Y possibly damaging Het
Ephb4 C A 5: 137,360,416 P287Q probably benign Het
Fat4 G T 3: 38,887,336 R126L probably benign Het
Flt3 T C 5: 147,334,909 M858V probably damaging Het
Gm13083 A T 4: 143,617,591 Y487F possibly damaging Het
Insr G T 8: 3,198,173 Y457* probably null Het
Ipo13 G A 4: 117,903,203 T649I possibly damaging Het
Krba1 A G 6: 48,415,744 D818G possibly damaging Het
Llgl1 G A 11: 60,712,980 G1016R probably benign Het
Loxl4 A G 19: 42,607,627 V142A probably benign Het
Mthfd1 A G 12: 76,294,218 I464V probably benign Het
Mycs C A X: 5,468,077 K316N probably damaging Het
Ncor2 A G 5: 125,026,775 probably benign Het
Nlrc3 A G 16: 3,964,045 F516S probably damaging Het
Oacyl A G 18: 65,749,672 S540G probably damaging Het
Olfml2a A T 2: 38,960,230 T653S probably damaging Het
Olfr285 C T 15: 98,313,488 V21I probably benign Het
Pcnx2 A T 8: 125,773,946 N1468K probably damaging Het
Plbd1 A G 6: 136,634,505 I258T probably damaging Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prop1 C T 11: 50,953,326 V27M probably damaging Het
Rfx4 T G 10: 84,814,761 probably null Het
Rgs11 C T 17: 26,203,463 probably benign Het
Slc6a5 T A 7: 49,945,512 F541I probably damaging Het
Srgap3 A T 6: 112,722,846 V1057E possibly damaging Het
Synpo2 A T 3: 123,114,297 W457R probably damaging Het
Tet2 T A 3: 133,487,960 N238Y possibly damaging Het
Tiam2 T A 17: 3,437,265 M687K probably damaging Het
Ticrr A G 7: 79,696,690 E1866G probably benign Het
Tspan8 T C 10: 115,833,251 S64P possibly damaging Het
Ugt2b37 C T 5: 87,254,406 G122D probably benign Het
Uqcrc2 A G 7: 120,637,888 E53G probably damaging Het
Vcan T C 13: 89,703,952 D963G probably damaging Het
Vmn2r24 T A 6: 123,787,267 Y368N possibly damaging Het
Wdr5 A G 2: 27,528,311 T208A probably benign Het
Zbtb18 A G 1: 177,448,370 Y423C probably damaging Het
Zc3h6 A G 2: 128,997,776 probably null Het
Other mutations in Gprin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Gprin3 APN 6 59353837 missense possibly damaging 0.72
IGL02059:Gprin3 APN 6 59355325 utr 5 prime probably benign
IGL02080:Gprin3 APN 6 59354191 missense possibly damaging 0.91
IGL02183:Gprin3 APN 6 59353162 missense possibly damaging 0.87
IGL02267:Gprin3 APN 6 59354473 missense probably benign 0.02
IGL02801:Gprin3 APN 6 59354981 missense possibly damaging 0.53
IGL03212:Gprin3 APN 6 59355028 missense probably benign
R0505:Gprin3 UTSW 6 59353387 missense probably damaging 0.98
R0944:Gprin3 UTSW 6 59353915 missense possibly damaging 0.72
R1028:Gprin3 UTSW 6 59354609 missense possibly damaging 0.53
R1180:Gprin3 UTSW 6 59354936 missense possibly damaging 0.86
R1290:Gprin3 UTSW 6 59354464 missense possibly damaging 0.53
R2060:Gprin3 UTSW 6 59354519 missense possibly damaging 0.73
R2403:Gprin3 UTSW 6 59354149 missense probably benign 0.13
R3830:Gprin3 UTSW 6 59353633 missense probably benign 0.12
R3893:Gprin3 UTSW 6 59354479 missense probably benign 0.12
R3983:Gprin3 UTSW 6 59354560 missense possibly damaging 0.72
R4812:Gprin3 UTSW 6 59353365 missense possibly damaging 0.85
R4932:Gprin3 UTSW 6 59354173 missense probably benign 0.33
R4944:Gprin3 UTSW 6 59354659 missense probably benign 0.00
R5523:Gprin3 UTSW 6 59353946 nonsense probably null
R5677:Gprin3 UTSW 6 59353892 missense possibly damaging 0.73
R5772:Gprin3 UTSW 6 59354413 missense possibly damaging 0.86
R5881:Gprin3 UTSW 6 59354786 missense probably benign 0.18
R6044:Gprin3 UTSW 6 59353672 missense possibly damaging 0.72
R6272:Gprin3 UTSW 6 59353331 nonsense probably null
R7140:Gprin3 UTSW 6 59355143 missense possibly damaging 0.85
R7528:Gprin3 UTSW 6 59354032 missense possibly damaging 0.85
R7891:Gprin3 UTSW 6 59353711 missense probably benign 0.22
R7974:Gprin3 UTSW 6 59353711 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TCTGAAGAACATGTGGCCCC -3'
(R):5'- AGGGATGCACCAAATACTAGC -3'

Sequencing Primer
(F):5'- AAGAACATGTGGCCCCTTTGC -3'
(R):5'- CACCTGTGCGGTACCTGAAG -3'
Posted On2017-02-10