Incidental Mutation 'R5879:Vmn2r24'
ID455713
Institutional Source Beutler Lab
Gene Symbol Vmn2r24
Ensembl Gene ENSMUSG00000072780
Gene Namevomeronasal 2, receptor 24
SynonymsEG243628
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5879 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location123778971-123816280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123787267 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 368 (Y368N)
Ref Sequence ENSEMBL: ENSMUSP00000074602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075095]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075095
AA Change: Y368N

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074602
Gene: ENSMUSG00000072780
AA Change: Y368N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 469 1.6e-32 PFAM
Pfam:NCD3G 518 571 1.1e-22 PFAM
Pfam:7tm_3 602 839 1.1e-54 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,874,658 L87P probably damaging Het
Aldh16a1 C T 7: 45,147,506 W66* probably null Het
Arhgap39 T C 15: 76,751,807 D76G probably damaging Het
Arhgef2 G A 3: 88,643,617 probably null Het
C1qtnf2 T C 11: 43,486,008 M99T probably damaging Het
Eml3 G A 19: 8,935,015 C392Y possibly damaging Het
Ephb4 C A 5: 137,360,416 P287Q probably benign Het
Fat4 G T 3: 38,887,336 R126L probably benign Het
Flt3 T C 5: 147,334,909 M858V probably damaging Het
Gm13083 A T 4: 143,617,591 Y487F possibly damaging Het
Gprin3 A C 6: 59,354,713 I203R probably benign Het
Insr G T 8: 3,198,173 Y457* probably null Het
Ipo13 G A 4: 117,903,203 T649I possibly damaging Het
Krba1 A G 6: 48,415,744 D818G possibly damaging Het
Llgl1 G A 11: 60,712,980 G1016R probably benign Het
Loxl4 A G 19: 42,607,627 V142A probably benign Het
Mthfd1 A G 12: 76,294,218 I464V probably benign Het
Mycs C A X: 5,468,077 K316N probably damaging Het
Ncor2 A G 5: 125,026,775 probably benign Het
Nlrc3 A G 16: 3,964,045 F516S probably damaging Het
Oacyl A G 18: 65,749,672 S540G probably damaging Het
Olfml2a A T 2: 38,960,230 T653S probably damaging Het
Olfr285 C T 15: 98,313,488 V21I probably benign Het
Pcnx2 A T 8: 125,773,946 N1468K probably damaging Het
Plbd1 A G 6: 136,634,505 I258T probably damaging Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prop1 C T 11: 50,953,326 V27M probably damaging Het
Rfx4 T G 10: 84,814,761 probably null Het
Rgs11 C T 17: 26,203,463 probably benign Het
Slc6a5 T A 7: 49,945,512 F541I probably damaging Het
Srgap3 A T 6: 112,722,846 V1057E possibly damaging Het
Synpo2 A T 3: 123,114,297 W457R probably damaging Het
Tet2 T A 3: 133,487,960 N238Y possibly damaging Het
Tiam2 T A 17: 3,437,265 M687K probably damaging Het
Ticrr A G 7: 79,696,690 E1866G probably benign Het
Tspan8 T C 10: 115,833,251 S64P possibly damaging Het
Ugt2b37 C T 5: 87,254,406 G122D probably benign Het
Uqcrc2 A G 7: 120,637,888 E53G probably damaging Het
Vcan T C 13: 89,703,952 D963G probably damaging Het
Wdr5 A G 2: 27,528,311 T208A probably benign Het
Zbtb18 A G 1: 177,448,370 Y423C probably damaging Het
Zc3h6 A G 2: 128,997,776 probably null Het
Other mutations in Vmn2r24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Vmn2r24 APN 6 123815637 missense probably damaging 1.00
IGL01382:Vmn2r24 APN 6 123786979 missense possibly damaging 0.62
IGL01592:Vmn2r24 APN 6 123787486 missense probably benign 0.30
IGL01754:Vmn2r24 APN 6 123804161 missense probably damaging 1.00
IGL01939:Vmn2r24 APN 6 123787445 missense probably benign
IGL02140:Vmn2r24 APN 6 123780672 missense probably damaging 0.98
IGL02272:Vmn2r24 APN 6 123786884 missense possibly damaging 0.94
IGL02568:Vmn2r24 APN 6 123815853 missense probably benign 0.36
IGL02748:Vmn2r24 APN 6 123816098 missense possibly damaging 0.90
IGL03022:Vmn2r24 APN 6 123779008 missense probably damaging 0.99
IGL03343:Vmn2r24 APN 6 123816111 missense probably damaging 1.00
R0357:Vmn2r24 UTSW 6 123815410 frame shift probably null
R0453:Vmn2r24 UTSW 6 123780391 critical splice acceptor site probably null
R0538:Vmn2r24 UTSW 6 123816053 missense probably benign 0.32
R0607:Vmn2r24 UTSW 6 123786934 missense probably benign
R1381:Vmn2r24 UTSW 6 123786733 missense probably damaging 1.00
R1589:Vmn2r24 UTSW 6 123806520 splice site probably benign
R1848:Vmn2r24 UTSW 6 123816224 missense probably damaging 1.00
R2035:Vmn2r24 UTSW 6 123816060 missense probably damaging 1.00
R2077:Vmn2r24 UTSW 6 123815399 missense probably damaging 1.00
R2122:Vmn2r24 UTSW 6 123815394 missense possibly damaging 0.81
R2145:Vmn2r24 UTSW 6 123779013 missense probably benign
R2483:Vmn2r24 UTSW 6 123816038 missense probably damaging 1.00
R2512:Vmn2r24 UTSW 6 123787026 missense probably benign 0.01
R3001:Vmn2r24 UTSW 6 123804272 missense probably benign 0.00
R3002:Vmn2r24 UTSW 6 123804272 missense probably benign 0.00
R3236:Vmn2r24 UTSW 6 123779025 nonsense probably null
R3623:Vmn2r24 UTSW 6 123816038 missense probably damaging 1.00
R3624:Vmn2r24 UTSW 6 123816038 missense probably damaging 1.00
R3835:Vmn2r24 UTSW 6 123787453 missense probably benign 0.33
R4074:Vmn2r24 UTSW 6 123787415 missense possibly damaging 0.92
R4075:Vmn2r24 UTSW 6 123787415 missense possibly damaging 0.92
R4812:Vmn2r24 UTSW 6 123779185 missense probably benign 0.00
R4825:Vmn2r24 UTSW 6 123815780 missense probably benign 0.02
R5351:Vmn2r24 UTSW 6 123816264 missense possibly damaging 0.80
R5665:Vmn2r24 UTSW 6 123786979 missense possibly damaging 0.62
R5790:Vmn2r24 UTSW 6 123815540 missense probably benign
R5808:Vmn2r24 UTSW 6 123815638 nonsense probably null
R5923:Vmn2r24 UTSW 6 123815792 missense probably damaging 0.96
R5969:Vmn2r24 UTSW 6 123779022 missense probably benign 0.00
R6050:Vmn2r24 UTSW 6 123815732 missense probably damaging 1.00
R6171:Vmn2r24 UTSW 6 123787246 missense probably damaging 0.98
R6174:Vmn2r24 UTSW 6 123816277 missense probably benign 0.00
R6356:Vmn2r24 UTSW 6 123806409 missense possibly damaging 0.93
R6562:Vmn2r24 UTSW 6 123780427 missense probably benign 0.01
R6563:Vmn2r24 UTSW 6 123804178 missense possibly damaging 0.86
R6584:Vmn2r24 UTSW 6 123815805 missense possibly damaging 0.53
R6630:Vmn2r24 UTSW 6 123787022 missense probably benign 0.00
R6803:Vmn2r24 UTSW 6 123779001 missense possibly damaging 0.64
R6864:Vmn2r24 UTSW 6 123779158 missense possibly damaging 0.89
R7252:Vmn2r24 UTSW 6 123787232 missense possibly damaging 0.90
R7369:Vmn2r24 UTSW 6 123815679 missense probably damaging 0.99
R7646:Vmn2r24 UTSW 6 123816210 missense probably benign 0.20
R7799:Vmn2r24 UTSW 6 123780463 missense probably benign 0.00
R7803:Vmn2r24 UTSW 6 123780479 missense probably benign 0.00
RF006:Vmn2r24 UTSW 6 123806419 missense probably damaging 1.00
RF016:Vmn2r24 UTSW 6 123804215 missense probably benign 0.04
X0023:Vmn2r24 UTSW 6 123787400 missense probably damaging 0.99
Z1088:Vmn2r24 UTSW 6 123804196 missense probably benign 0.00
Z1177:Vmn2r24 UTSW 6 123786760 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCATTTGGTGACACTCATGATTTTC -3'
(R):5'- ACTCTGAGTGACAGCTCCTCATG -3'

Sequencing Primer
(F):5'- GGTGACACTCATGATTTTCTGATTAG -3'
(R):5'- TCCTCATGGAGTGCCTGG -3'
Posted On2017-02-10