Incidental Mutation 'R5879:Slc6a5'
ID455717
Institutional Source Beutler Lab
Gene Symbol Slc6a5
Ensembl Gene ENSMUSG00000039728
Gene Namesolute carrier family 6 (neurotransmitter transporter, glycine), member 5
SynonymsGlyt2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5879 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location49910146-49963856 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49945512 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 541 (F541I)
Ref Sequence ENSEMBL: ENSMUSP00000146917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056442] [ENSMUST00000107605] [ENSMUST00000207753] [ENSMUST00000209172]
Predicted Effect probably damaging
Transcript: ENSMUST00000056442
AA Change: F541I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058699
Gene: ENSMUSG00000039728
AA Change: F541I

DomainStartEndE-ValueType
Pfam:SNF 185 734 1.6e-218 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107605
AA Change: F541I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103230
Gene: ENSMUSG00000039728
AA Change: F541I

DomainStartEndE-ValueType
Pfam:SNF 185 734 1.6e-218 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207753
AA Change: F541I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000209172
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium- and chloride-dependent glycine neurotransmitter transporter. This integral membrane glycoprotein is responsible for the clearance of extracellular glycine during glycine-mediated neurotransmission. This protein is found in glycinergic axons and maintains a high presynaptic pool of neurotransmitter at glycinergic synapses. Mutations in this gene cause hyperekplexia; a heterogenous neurological disorder characterized by exaggerated startle responses and neonatal apnea. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutant mice appear normal at birth but develop a complex neuromotor phenotype involving tremors, rigidity, and an impaired righting ability. Mutant mice die approximately 2 weeks after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,874,658 L87P probably damaging Het
Aldh16a1 C T 7: 45,147,506 W66* probably null Het
Arhgap39 T C 15: 76,751,807 D76G probably damaging Het
Arhgef2 G A 3: 88,643,617 probably null Het
C1qtnf2 T C 11: 43,486,008 M99T probably damaging Het
Eml3 G A 19: 8,935,015 C392Y possibly damaging Het
Ephb4 C A 5: 137,360,416 P287Q probably benign Het
Fat4 G T 3: 38,887,336 R126L probably benign Het
Flt3 T C 5: 147,334,909 M858V probably damaging Het
Gm13083 A T 4: 143,617,591 Y487F possibly damaging Het
Gprin3 A C 6: 59,354,713 I203R probably benign Het
Insr G T 8: 3,198,173 Y457* probably null Het
Ipo13 G A 4: 117,903,203 T649I possibly damaging Het
Krba1 A G 6: 48,415,744 D818G possibly damaging Het
Llgl1 G A 11: 60,712,980 G1016R probably benign Het
Loxl4 A G 19: 42,607,627 V142A probably benign Het
Mthfd1 A G 12: 76,294,218 I464V probably benign Het
Mycs C A X: 5,468,077 K316N probably damaging Het
Ncor2 A G 5: 125,026,775 probably benign Het
Nlrc3 A G 16: 3,964,045 F516S probably damaging Het
Oacyl A G 18: 65,749,672 S540G probably damaging Het
Olfml2a A T 2: 38,960,230 T653S probably damaging Het
Olfr285 C T 15: 98,313,488 V21I probably benign Het
Pcnx2 A T 8: 125,773,946 N1468K probably damaging Het
Plbd1 A G 6: 136,634,505 I258T probably damaging Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prop1 C T 11: 50,953,326 V27M probably damaging Het
Rfx4 T G 10: 84,814,761 probably null Het
Rgs11 C T 17: 26,203,463 probably benign Het
Srgap3 A T 6: 112,722,846 V1057E possibly damaging Het
Synpo2 A T 3: 123,114,297 W457R probably damaging Het
Tet2 T A 3: 133,487,960 N238Y possibly damaging Het
Tiam2 T A 17: 3,437,265 M687K probably damaging Het
Ticrr A G 7: 79,696,690 E1866G probably benign Het
Tspan8 T C 10: 115,833,251 S64P possibly damaging Het
Ugt2b37 C T 5: 87,254,406 G122D probably benign Het
Uqcrc2 A G 7: 120,637,888 E53G probably damaging Het
Vcan T C 13: 89,703,952 D963G probably damaging Het
Vmn2r24 T A 6: 123,787,267 Y368N possibly damaging Het
Wdr5 A G 2: 27,528,311 T208A probably benign Het
Zbtb18 A G 1: 177,448,370 Y423C probably damaging Het
Zc3h6 A G 2: 128,997,776 probably null Het
Other mutations in Slc6a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Slc6a5 APN 7 49917733 missense probably benign 0.35
IGL01821:Slc6a5 APN 7 49914853 intron probably benign
R0084:Slc6a5 UTSW 7 49930013 missense probably benign 0.01
R0266:Slc6a5 UTSW 7 49938408 splice site probably benign
R0411:Slc6a5 UTSW 7 49911791 missense probably damaging 1.00
R0621:Slc6a5 UTSW 7 49917365 splice site probably null
R1649:Slc6a5 UTSW 7 49936262 missense probably damaging 1.00
R1822:Slc6a5 UTSW 7 49956425 missense probably benign 0.00
R1889:Slc6a5 UTSW 7 49951434 missense probably benign 0.03
R2084:Slc6a5 UTSW 7 49948254 missense probably benign 0.14
R2098:Slc6a5 UTSW 7 49945567 missense probably damaging 1.00
R2365:Slc6a5 UTSW 7 49946536 missense possibly damaging 0.93
R2516:Slc6a5 UTSW 7 49956462 missense probably benign 0.00
R3622:Slc6a5 UTSW 7 49917623 missense probably benign 0.16
R3752:Slc6a5 UTSW 7 49936314 critical splice donor site probably null
R3848:Slc6a5 UTSW 7 49927558 splice site probably benign
R3917:Slc6a5 UTSW 7 49911869 missense probably damaging 1.00
R4617:Slc6a5 UTSW 7 49912020 missense probably benign 0.00
R4663:Slc6a5 UTSW 7 49938398 nonsense probably null
R4757:Slc6a5 UTSW 7 49959282 missense probably benign 0.15
R4916:Slc6a5 UTSW 7 49948256 missense probably benign 0.00
R5183:Slc6a5 UTSW 7 49936209 missense probably damaging 0.97
R5257:Slc6a5 UTSW 7 49929992 missense probably damaging 0.98
R5512:Slc6a5 UTSW 7 49941825 missense probably damaging 1.00
R5537:Slc6a5 UTSW 7 49959311 missense probably benign 0.03
R5558:Slc6a5 UTSW 7 49927573 missense probably benign
R5627:Slc6a5 UTSW 7 49911774 missense possibly damaging 0.85
R5655:Slc6a5 UTSW 7 49956470 missense probably benign
R5720:Slc6a5 UTSW 7 49956516 missense possibly damaging 0.86
R5736:Slc6a5 UTSW 7 49959354 missense probably benign 0.03
R5817:Slc6a5 UTSW 7 49956491 missense probably benign 0.00
R6033:Slc6a5 UTSW 7 49959351 missense probably benign 0.01
R6033:Slc6a5 UTSW 7 49959351 missense probably benign 0.01
R6072:Slc6a5 UTSW 7 49912195 missense probably damaging 1.00
R6157:Slc6a5 UTSW 7 49951502 missense probably benign 0.03
R6172:Slc6a5 UTSW 7 49948333 nonsense probably null
R6414:Slc6a5 UTSW 7 49910243 unclassified probably benign
R7348:Slc6a5 UTSW 7 49910167 unclassified probably benign
R7381:Slc6a5 UTSW 7 49930056 missense probably damaging 1.00
R7486:Slc6a5 UTSW 7 49917330 missense possibly damaging 0.81
R7624:Slc6a5 UTSW 7 49941866 missense probably benign 0.00
R7735:Slc6a5 UTSW 7 49948342 critical splice donor site probably null
R7760:Slc6a5 UTSW 7 49946617 missense probably benign 0.03
Z1088:Slc6a5 UTSW 7 49911857 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GGAAGGCTGGTCTAATGAGC -3'
(R):5'- AGACATTACTCAAGAGATGCCTC -3'

Sequencing Primer
(F):5'- TGGTCTAATGAGCAGAGATGAGC -3'
(R):5'- ATAAGCCTAAGCCTTTTCTGCAGG -3'
Posted On2017-02-10