Mutagenetix > Incidental Mutation

Incidental Mutation 'R5879:Ticrr'

455718

Institutional Source

Beutler Lab

Gene Symbol

Ticrr

Ensembl Gene

ENSMUSG00000046591

Gene Name

TOPBP1-interacting checkpoint and replication regulator

Synonyms

5730590G19Rik

Accession Numbers

Essential gene?

Probably essential (E-score: 0.953) question?

Stock #

R5879 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79660196-79698148 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 79696690 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1866 (E1866G)

Ref Sequence

ENSEMBL: ENSMUSP00000041377 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000059836] [ENSMUST00000178048] [ENSMUST00000183846] [ENSMUST00000184137] [ENSMUST00000206591] [ENSMUST00000206622]

AlphaFold

Q8BQ33

Predicted Effect

probably benign
Transcript: ENSMUST00000035977
AA Change: E1866G

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: E1866G

Domain	Start	End	E-Value	Type
low complexity region	23	31	N/A	INTRINSIC
Pfam:Treslin_N	211	1005	N/A	PFAM
low complexity region	1186	1197	N/A	INTRINSIC
low complexity region	1220	1235	N/A	INTRINSIC
low complexity region	1339	1359	N/A	INTRINSIC
low complexity region	1472	1480	N/A	INTRINSIC
low complexity region	1496	1514	N/A	INTRINSIC
low complexity region	1630	1643	N/A	INTRINSIC
low complexity region	1694	1707	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000059836

SMART Domains

Protein: ENSMUSP00000061806
Gene: ENSMUSG00000050382

Domain	Start	End	E-Value	Type
KISc	13	357	2.88e-143	SMART
low complexity region	391	410	N/A	INTRINSIC
Blast:KISc	413	481	1e-19	BLAST
Blast:KISc	482	518	3e-11	BLAST
low complexity region	523	540	N/A	INTRINSIC
low complexity region	543	557	N/A	INTRINSIC
low complexity region	621	636	N/A	INTRINSIC
low complexity region	669	685	N/A	INTRINSIC
Blast:KISc	780	879	2e-15	BLAST
low complexity region	927	944	N/A	INTRINSIC
low complexity region	979	993	N/A	INTRINSIC
low complexity region	1049	1061	N/A	INTRINSIC
coiled coil region	1113	1139	N/A	INTRINSIC
coiled coil region	1186	1205	N/A	INTRINSIC
low complexity region	1293	1304	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000178048

SMART Domains

Protein: ENSMUSP00000136993
Gene: ENSMUSG00000050382

Domain	Start	End	E-Value	Type
KISc	13	357	2.88e-143	SMART
low complexity region	391	410	N/A	INTRINSIC
Blast:KISc	413	481	1e-19	BLAST
Blast:KISc	482	518	3e-11	BLAST
low complexity region	523	540	N/A	INTRINSIC
low complexity region	543	557	N/A	INTRINSIC
low complexity region	621	636	N/A	INTRINSIC
low complexity region	669	685	N/A	INTRINSIC
Blast:KISc	780	879	2e-15	BLAST
low complexity region	908	918	N/A	INTRINSIC
low complexity region	928	945	N/A	INTRINSIC
low complexity region	980	994	N/A	INTRINSIC
low complexity region	1050	1062	N/A	INTRINSIC
coiled coil region	1114	1140	N/A	INTRINSIC
coiled coil region	1187	1206	N/A	INTRINSIC
low complexity region	1294	1305	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000183846

SMART Domains

Protein: ENSMUSP00000139359
Gene: ENSMUSG00000050382

Domain	Start	End	E-Value	Type
KISc	13	357	2.88e-143	SMART
low complexity region	391	410	N/A	INTRINSIC
Blast:KISc	413	481	1e-19	BLAST
Blast:KISc	482	518	3e-11	BLAST
low complexity region	523	540	N/A	INTRINSIC
low complexity region	543	557	N/A	INTRINSIC
low complexity region	621	636	N/A	INTRINSIC
low complexity region	669	685	N/A	INTRINSIC
Blast:KISc	780	879	2e-15	BLAST
low complexity region	908	918	N/A	INTRINSIC
low complexity region	928	945	N/A	INTRINSIC
low complexity region	980	994	N/A	INTRINSIC
low complexity region	1050	1062	N/A	INTRINSIC
coiled coil region	1114	1140	N/A	INTRINSIC
coiled coil region	1187	1206	N/A	INTRINSIC
low complexity region	1294	1305	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000184137

SMART Domains

Protein: ENSMUSP00000139224
Gene: ENSMUSG00000050382

Domain	Start	End	E-Value	Type
KISc	13	357	2.88e-143	SMART
low complexity region	391	410	N/A	INTRINSIC
Blast:KISc	413	481	1e-19	BLAST
Blast:KISc	482	518	3e-11	BLAST
low complexity region	523	540	N/A	INTRINSIC
low complexity region	543	557	N/A	INTRINSIC
low complexity region	621	636	N/A	INTRINSIC
low complexity region	669	685	N/A	INTRINSIC
Blast:KISc	780	879	2e-15	BLAST
low complexity region	927	944	N/A	INTRINSIC
low complexity region	979	993	N/A	INTRINSIC
low complexity region	1049	1061	N/A	INTRINSIC
coiled coil region	1113	1139	N/A	INTRINSIC
coiled coil region	1186	1205	N/A	INTRINSIC
low complexity region	1293	1304	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000206591

Predicted Effect

probably benign
Transcript: ENSMUST00000206622

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110062M04Rik	A	G	6: 34,874,658	L87P	probably damaging	Het
Aldh16a1	C	T	7: 45,147,506	W66*	probably null	Het
Arhgap39	T	C	15: 76,751,807	D76G	probably damaging	Het
Arhgef2	G	A	3: 88,643,617		probably null	Het
C1qtnf2	T	C	11: 43,486,008	M99T	probably damaging	Het
Eml3	G	A	19: 8,935,015	C392Y	possibly damaging	Het
Ephb4	C	A	5: 137,360,416	P287Q	probably benign	Het
Fat4	G	T	3: 38,887,336	R126L	probably benign	Het
Flt3	T	C	5: 147,334,909	M858V	probably damaging	Het
Gm13083	A	T	4: 143,617,591	Y487F	possibly damaging	Het
Gprin3	A	C	6: 59,354,713	I203R	probably benign	Het
Insr	G	T	8: 3,198,173	Y457*	probably null	Het
Ipo13	G	A	4: 117,903,203	T649I	possibly damaging	Het
Krba1	A	G	6: 48,415,744	D818G	possibly damaging	Het
Llgl1	G	A	11: 60,712,980	G1016R	probably benign	Het
Loxl4	A	G	19: 42,607,627	V142A	probably benign	Het
Mthfd1	A	G	12: 76,294,218	I464V	probably benign	Het
Mycs	C	A	X: 5,468,077	K316N	probably damaging	Het
Ncor2	A	G	5: 125,026,775		probably benign	Het
Nlrc3	A	G	16: 3,964,045	F516S	probably damaging	Het
Oacyl	A	G	18: 65,749,672	S540G	probably damaging	Het
Olfml2a	A	T	2: 38,960,230	T653S	probably damaging	Het
Olfr285	C	T	15: 98,313,488	V21I	probably benign	Het
Pcnx2	A	T	8: 125,773,946	N1468K	probably damaging	Het
Plbd1	A	G	6: 136,634,505	I258T	probably damaging	Het
Ppargc1b	C	G	18: 61,309,093	D591H	probably damaging	Het
Prop1	C	T	11: 50,953,326	V27M	probably damaging	Het
Rfx4	T	G	10: 84,814,761		probably null	Het
Rgs11	C	T	17: 26,203,463		probably benign	Het
Slc6a5	T	A	7: 49,945,512	F541I	probably damaging	Het
Srgap3	A	T	6: 112,722,846	V1057E	possibly damaging	Het
Synpo2	A	T	3: 123,114,297	W457R	probably damaging	Het
Tet2	T	A	3: 133,487,960	N238Y	possibly damaging	Het
Tiam2	T	A	17: 3,437,265	M687K	probably damaging	Het
Tspan8	T	C	10: 115,833,251	S64P	possibly damaging	Het
Ugt2b37	C	T	5: 87,254,406	G122D	probably benign	Het
Uqcrc2	A	G	7: 120,637,888	E53G	probably damaging	Het
Vcan	T	C	13: 89,703,952	D963G	probably damaging	Het
Vmn2r24	T	A	6: 123,787,267	Y368N	possibly damaging	Het
Wdr5	A	G	2: 27,528,311	T208A	probably benign	Het
Zbtb18	A	G	1: 177,448,370	Y423C	probably damaging	Het
Zc3h6	A	G	2: 128,997,776		probably null	Het

Other mutations in Ticrr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Ticrr	APN	7	79677283	missense	probably damaging	1.00
IGL00596:Ticrr	APN	7	79677293	missense	probably damaging	1.00
IGL01327:Ticrr	APN	7	79694461	missense	probably benign	0.00
IGL01525:Ticrr	APN	7	79682449	missense	probably damaging	1.00
IGL01565:Ticrr	APN	7	79694548	missense	probably benign
IGL01936:Ticrr	APN	7	79694549	missense	probably benign	0.11
IGL02160:Ticrr	APN	7	79694019	missense	probably benign	0.29
IGL02246:Ticrr	APN	7	79675328	missense	probably damaging	1.00
IGL02487:Ticrr	APN	7	79683021	missense	possibly damaging	0.86
IGL02593:Ticrr	APN	7	79695466	missense	probably damaging	0.99
IGL02970:Ticrr	APN	7	79695171	missense	probably benign	0.01
FR4304:Ticrr	UTSW	7	79694311	intron	probably benign
PIT4305001:Ticrr	UTSW	7	79679023	missense	possibly damaging	0.95
PIT4791001:Ticrr	UTSW	7	79669638	missense	possibly damaging	0.92
R0016:Ticrr	UTSW	7	79693792	missense	probably benign	0.01
R0062:Ticrr	UTSW	7	79667906	missense	probably benign	0.01
R0062:Ticrr	UTSW	7	79667906	missense	probably benign	0.01
R0067:Ticrr	UTSW	7	79677410	missense	probably damaging	1.00
R0067:Ticrr	UTSW	7	79677410	missense	probably damaging	1.00
R0362:Ticrr	UTSW	7	79677340	missense	probably damaging	1.00
R0482:Ticrr	UTSW	7	79694488	missense	probably damaging	0.99
R0595:Ticrr	UTSW	7	79695563	missense	possibly damaging	0.94
R1118:Ticrr	UTSW	7	79693953	missense	probably benign	0.23
R1119:Ticrr	UTSW	7	79693953	missense	probably benign	0.23
R1572:Ticrr	UTSW	7	79681824	missense	probably damaging	1.00
R1658:Ticrr	UTSW	7	79695549	missense	possibly damaging	0.57
R1757:Ticrr	UTSW	7	79675323	missense	probably damaging	0.99
R1757:Ticrr	UTSW	7	79679046	nonsense	probably null
R1862:Ticrr	UTSW	7	79695207	missense	probably damaging	1.00
R1869:Ticrr	UTSW	7	79679135	missense	probably damaging	1.00
R1938:Ticrr	UTSW	7	79675394	missense	probably damaging	0.98
R1966:Ticrr	UTSW	7	79694735	nonsense	probably null
R2006:Ticrr	UTSW	7	79694073	missense	possibly damaging	0.93
R2178:Ticrr	UTSW	7	79665685	missense	probably benign	0.12
R3404:Ticrr	UTSW	7	79694791	missense	probably benign	0.06
R3405:Ticrr	UTSW	7	79694791	missense	probably benign	0.06
R3941:Ticrr	UTSW	7	79693697	intron	probably benign
R3950:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R3951:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R3952:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R4967:Ticrr	UTSW	7	79660410	missense	probably damaging	0.99
R4972:Ticrr	UTSW	7	79669668	missense	probably damaging	0.98
R5259:Ticrr	UTSW	7	79694723	missense	probably benign	0.01
R5272:Ticrr	UTSW	7	79669605	missense	probably benign	0.44
R5374:Ticrr	UTSW	7	79690942	nonsense	probably null
R5480:Ticrr	UTSW	7	79660809	missense	probably damaging	1.00
R5568:Ticrr	UTSW	7	79689967	critical splice donor site	probably null
R5568:Ticrr	UTSW	7	79695296	nonsense	probably null
R5588:Ticrr	UTSW	7	79679105	missense	probably damaging	1.00
R5698:Ticrr	UTSW	7	79679133	missense	probably benign
R5980:Ticrr	UTSW	7	79660955	missense	probably damaging	0.99
R6128:Ticrr	UTSW	7	79693968	missense	probably damaging	1.00
R6277:Ticrr	UTSW	7	79694696	missense	probably benign	0.00
R6335:Ticrr	UTSW	7	79694283	splice site	probably null
R6866:Ticrr	UTSW	7	79693957	missense	possibly damaging	0.47
R6905:Ticrr	UTSW	7	79665850	missense	probably benign	0.00
R6923:Ticrr	UTSW	7	79691853	missense	probably damaging	0.98
R6962:Ticrr	UTSW	7	79665897	missense	possibly damaging	0.84
R7232:Ticrr	UTSW	7	79693742	missense	probably damaging	0.96
R7285:Ticrr	UTSW	7	79660862	missense	possibly damaging	0.93
R7385:Ticrr	UTSW	7	79691849	missense	possibly damaging	0.93
R7426:Ticrr	UTSW	7	79693986	missense	probably benign
R7583:Ticrr	UTSW	7	79696739	nonsense	probably null
R7749:Ticrr	UTSW	7	79679096	missense	possibly damaging	0.94
R7863:Ticrr	UTSW	7	79682012	missense	possibly damaging	0.92
R7899:Ticrr	UTSW	7	79669485	missense	probably benign	0.23
R7935:Ticrr	UTSW	7	79681836	missense	probably damaging	0.99
R8005:Ticrr	UTSW	7	79694048	missense	probably damaging	0.98
R8080:Ticrr	UTSW	7	79684264	splice site	probably null
R8181:Ticrr	UTSW	7	79660980	missense	possibly damaging	0.92
R8349:Ticrr	UTSW	7	79694680	missense	probably benign	0.27
R8410:Ticrr	UTSW	7	79667675	missense	probably damaging	0.98
R8449:Ticrr	UTSW	7	79694680	missense	probably benign	0.27
R9073:Ticrr	UTSW	7	79667931	missense	probably benign	0.01
R9090:Ticrr	UTSW	7	79660856	missense	possibly damaging	0.85
R9271:Ticrr	UTSW	7	79660856	missense	possibly damaging	0.85
R9287:Ticrr	UTSW	7	79693768	missense	possibly damaging	0.89
R9368:Ticrr	UTSW	7	79680987	missense	probably damaging	0.99
R9469:Ticrr	UTSW	7	79694763	missense	probably benign	0.03
R9502:Ticrr	UTSW	7	79693849	missense	probably benign
R9614:Ticrr	UTSW	7	79696006	missense	probably damaging	1.00
R9761:Ticrr	UTSW	7	79695565	missense	probably damaging	1.00
R9779:Ticrr	UTSW	7	79679054	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- AAGAAAGCCTTTTGTGCGGAC -3'
(R):5'- TGTTCTGGGCACAATGCTAG -3'

Sequencing Primer
(F):5'- CGGACACACAAGCAATTTTCAGTTG -3'
(R):5'- CACAATGCTAGATTGCTGGC -3'

Posted On

2017-02-10