Incidental Mutation 'R5879:Ticrr'
ID 455718
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R5879 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 79309944-79347896 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 79346438 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1866 (E1866G)
Ref Sequence ENSEMBL: ENSMUSP00000041377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000059836] [ENSMUST00000178048] [ENSMUST00000183846] [ENSMUST00000184137] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect probably benign
Transcript: ENSMUST00000035977
AA Change: E1866G

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: E1866G

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059836
SMART Domains Protein: ENSMUSP00000061806
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178048
SMART Domains Protein: ENSMUSP00000136993
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183846
SMART Domains Protein: ENSMUSP00000139359
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184137
SMART Domains Protein: ENSMUSP00000139224
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206591
Predicted Effect probably benign
Transcript: ENSMUST00000206622
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh16a1 C T 7: 44,796,930 (GRCm39) W66* probably null Het
Arhgap39 T C 15: 76,636,007 (GRCm39) D76G probably damaging Het
Arhgef2 G A 3: 88,550,924 (GRCm39) probably null Het
C1qtnf2 T C 11: 43,376,835 (GRCm39) M99T probably damaging Het
Cyren A G 6: 34,851,593 (GRCm39) L87P probably damaging Het
Eml3 G A 19: 8,912,379 (GRCm39) C392Y possibly damaging Het
Ephb4 C A 5: 137,358,678 (GRCm39) P287Q probably benign Het
Fat4 G T 3: 38,941,485 (GRCm39) R126L probably benign Het
Flt3 T C 5: 147,271,719 (GRCm39) M858V probably damaging Het
Gprin3 A C 6: 59,331,698 (GRCm39) I203R probably benign Het
Insr G T 8: 3,248,173 (GRCm39) Y457* probably null Het
Ipo13 G A 4: 117,760,400 (GRCm39) T649I possibly damaging Het
Krba1 A G 6: 48,392,678 (GRCm39) D818G possibly damaging Het
Llgl1 G A 11: 60,603,806 (GRCm39) G1016R probably benign Het
Loxl4 A G 19: 42,596,066 (GRCm39) V142A probably benign Het
Mthfd1 A G 12: 76,340,992 (GRCm39) I464V probably benign Het
Mycs C A X: 5,380,131 (GRCm39) K316N probably damaging Het
Ncor2 A G 5: 125,103,839 (GRCm39) probably benign Het
Nlrc3 A G 16: 3,781,909 (GRCm39) F516S probably damaging Het
Oacyl A G 18: 65,882,743 (GRCm39) S540G probably damaging Het
Olfml2a A T 2: 38,850,242 (GRCm39) T653S probably damaging Het
Or8s16 C T 15: 98,211,369 (GRCm39) V21I probably benign Het
Pcnx2 A T 8: 126,500,685 (GRCm39) N1468K probably damaging Het
Plbd1 A G 6: 136,611,503 (GRCm39) I258T probably damaging Het
Ppargc1b C G 18: 61,442,164 (GRCm39) D591H probably damaging Het
Pramel21 A T 4: 143,344,161 (GRCm39) Y487F possibly damaging Het
Prop1 C T 11: 50,844,153 (GRCm39) V27M probably damaging Het
Rfx4 T G 10: 84,650,625 (GRCm39) probably null Het
Rgs11 C T 17: 26,422,437 (GRCm39) probably benign Het
Slc6a5 T A 7: 49,595,260 (GRCm39) F541I probably damaging Het
Srgap3 A T 6: 112,699,807 (GRCm39) V1057E possibly damaging Het
Synpo2 A T 3: 122,907,946 (GRCm39) W457R probably damaging Het
Tet2 T A 3: 133,193,721 (GRCm39) N238Y possibly damaging Het
Tiam2 T A 17: 3,487,540 (GRCm39) M687K probably damaging Het
Tspan8 T C 10: 115,669,156 (GRCm39) S64P possibly damaging Het
Ugt2b37 C T 5: 87,402,265 (GRCm39) G122D probably benign Het
Uqcrc2 A G 7: 120,237,111 (GRCm39) E53G probably damaging Het
Vcan T C 13: 89,852,071 (GRCm39) D963G probably damaging Het
Vmn2r24 T A 6: 123,764,226 (GRCm39) Y368N possibly damaging Het
Wdr5 A G 2: 27,418,323 (GRCm39) T208A probably benign Het
Zbtb18 A G 1: 177,275,936 (GRCm39) Y423C probably damaging Het
Zc3h6 A G 2: 128,839,696 (GRCm39) probably null Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79,327,031 (GRCm39) missense probably damaging 1.00
IGL00596:Ticrr APN 7 79,327,041 (GRCm39) missense probably damaging 1.00
IGL01327:Ticrr APN 7 79,344,209 (GRCm39) missense probably benign 0.00
IGL01525:Ticrr APN 7 79,332,197 (GRCm39) missense probably damaging 1.00
IGL01565:Ticrr APN 7 79,344,296 (GRCm39) missense probably benign
IGL01936:Ticrr APN 7 79,344,297 (GRCm39) missense probably benign 0.11
IGL02160:Ticrr APN 7 79,343,767 (GRCm39) missense probably benign 0.29
IGL02246:Ticrr APN 7 79,325,076 (GRCm39) missense probably damaging 1.00
IGL02487:Ticrr APN 7 79,332,769 (GRCm39) missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79,345,214 (GRCm39) missense probably damaging 0.99
IGL02970:Ticrr APN 7 79,344,919 (GRCm39) missense probably benign 0.01
FR4304:Ticrr UTSW 7 79,344,059 (GRCm39) intron probably benign
PIT4305001:Ticrr UTSW 7 79,328,771 (GRCm39) missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79,319,386 (GRCm39) missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79,343,540 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0362:Ticrr UTSW 7 79,327,088 (GRCm39) missense probably damaging 1.00
R0482:Ticrr UTSW 7 79,344,236 (GRCm39) missense probably damaging 0.99
R0595:Ticrr UTSW 7 79,345,311 (GRCm39) missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1119:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1572:Ticrr UTSW 7 79,331,572 (GRCm39) missense probably damaging 1.00
R1658:Ticrr UTSW 7 79,345,297 (GRCm39) missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79,328,794 (GRCm39) nonsense probably null
R1757:Ticrr UTSW 7 79,325,071 (GRCm39) missense probably damaging 0.99
R1862:Ticrr UTSW 7 79,344,955 (GRCm39) missense probably damaging 1.00
R1869:Ticrr UTSW 7 79,328,883 (GRCm39) missense probably damaging 1.00
R1938:Ticrr UTSW 7 79,325,142 (GRCm39) missense probably damaging 0.98
R1966:Ticrr UTSW 7 79,344,483 (GRCm39) nonsense probably null
R2006:Ticrr UTSW 7 79,343,821 (GRCm39) missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79,315,433 (GRCm39) missense probably benign 0.12
R3404:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3405:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3941:Ticrr UTSW 7 79,343,445 (GRCm39) intron probably benign
R3950:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3951:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3952:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R4967:Ticrr UTSW 7 79,310,158 (GRCm39) missense probably damaging 0.99
R4972:Ticrr UTSW 7 79,319,416 (GRCm39) missense probably damaging 0.98
R5259:Ticrr UTSW 7 79,344,471 (GRCm39) missense probably benign 0.01
R5272:Ticrr UTSW 7 79,319,353 (GRCm39) missense probably benign 0.44
R5374:Ticrr UTSW 7 79,340,690 (GRCm39) nonsense probably null
R5480:Ticrr UTSW 7 79,310,557 (GRCm39) missense probably damaging 1.00
R5568:Ticrr UTSW 7 79,345,044 (GRCm39) nonsense probably null
R5568:Ticrr UTSW 7 79,339,715 (GRCm39) critical splice donor site probably null
R5588:Ticrr UTSW 7 79,328,853 (GRCm39) missense probably damaging 1.00
R5698:Ticrr UTSW 7 79,328,881 (GRCm39) missense probably benign
R5980:Ticrr UTSW 7 79,310,703 (GRCm39) missense probably damaging 0.99
R6128:Ticrr UTSW 7 79,343,716 (GRCm39) missense probably damaging 1.00
R6277:Ticrr UTSW 7 79,344,444 (GRCm39) missense probably benign 0.00
R6335:Ticrr UTSW 7 79,344,031 (GRCm39) splice site probably null
R6866:Ticrr UTSW 7 79,343,705 (GRCm39) missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79,315,598 (GRCm39) missense probably benign 0.00
R6923:Ticrr UTSW 7 79,341,601 (GRCm39) missense probably damaging 0.98
R6962:Ticrr UTSW 7 79,315,645 (GRCm39) missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79,343,490 (GRCm39) missense probably damaging 0.96
R7285:Ticrr UTSW 7 79,310,610 (GRCm39) missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79,341,597 (GRCm39) missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79,343,734 (GRCm39) missense probably benign
R7583:Ticrr UTSW 7 79,346,487 (GRCm39) nonsense probably null
R7749:Ticrr UTSW 7 79,328,844 (GRCm39) missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79,331,760 (GRCm39) missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79,319,233 (GRCm39) missense probably benign 0.23
R7935:Ticrr UTSW 7 79,331,584 (GRCm39) missense probably damaging 0.99
R8005:Ticrr UTSW 7 79,343,796 (GRCm39) missense probably damaging 0.98
R8080:Ticrr UTSW 7 79,334,012 (GRCm39) splice site probably null
R8181:Ticrr UTSW 7 79,310,728 (GRCm39) missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R8410:Ticrr UTSW 7 79,317,423 (GRCm39) missense probably damaging 0.98
R8449:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R9073:Ticrr UTSW 7 79,317,679 (GRCm39) missense probably benign 0.01
R9090:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79,343,516 (GRCm39) missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79,330,735 (GRCm39) missense probably damaging 0.99
R9469:Ticrr UTSW 7 79,344,511 (GRCm39) missense probably benign 0.03
R9502:Ticrr UTSW 7 79,343,597 (GRCm39) missense probably benign
R9614:Ticrr UTSW 7 79,345,754 (GRCm39) missense probably damaging 1.00
R9761:Ticrr UTSW 7 79,345,313 (GRCm39) missense probably damaging 1.00
R9779:Ticrr UTSW 7 79,328,802 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AAGAAAGCCTTTTGTGCGGAC -3'
(R):5'- TGTTCTGGGCACAATGCTAG -3'

Sequencing Primer
(F):5'- CGGACACACAAGCAATTTTCAGTTG -3'
(R):5'- CACAATGCTAGATTGCTGGC -3'
Posted On 2017-02-10