Incidental Mutation 'R5879:Tspan8'
ID455725
Institutional Source Beutler Lab
Gene Symbol Tspan8
Ensembl Gene ENSMUSG00000034127
Gene Nametetraspanin 8
SynonymsTm4sf3, E330007O21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R5879 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location115816832-115849893 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115833251 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 64 (S64P)
Ref Sequence ENSEMBL: ENSMUSP00000136645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035563] [ENSMUST00000080630] [ENSMUST00000179196] [ENSMUST00000217900]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035563
AA Change: S64P

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049243
Gene: ENSMUSG00000034127
AA Change: S64P

DomainStartEndE-ValueType
Pfam:Tetraspannin 7 232 4.8e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000080630
AA Change: S64P

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079463
Gene: ENSMUSG00000034127
AA Change: S64P

DomainStartEndE-ValueType
Pfam:Tetraspannin 7 232 8.3e-52 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000179196
AA Change: S64P

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136645
Gene: ENSMUSG00000034127
AA Change: S64P

DomainStartEndE-ValueType
Pfam:Tetraspannin 7 232 8.3e-52 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217900
AA Change: S64P

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220081
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins. This gene is expressed in different carcinomas. The use of alternate polyadenylation sites has been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,874,658 L87P probably damaging Het
Aldh16a1 C T 7: 45,147,506 W66* probably null Het
Arhgap39 T C 15: 76,751,807 D76G probably damaging Het
Arhgef2 G A 3: 88,643,617 probably null Het
C1qtnf2 T C 11: 43,486,008 M99T probably damaging Het
Eml3 G A 19: 8,935,015 C392Y possibly damaging Het
Ephb4 C A 5: 137,360,416 P287Q probably benign Het
Fat4 G T 3: 38,887,336 R126L probably benign Het
Flt3 T C 5: 147,334,909 M858V probably damaging Het
Gm13083 A T 4: 143,617,591 Y487F possibly damaging Het
Gprin3 A C 6: 59,354,713 I203R probably benign Het
Insr G T 8: 3,198,173 Y457* probably null Het
Ipo13 G A 4: 117,903,203 T649I possibly damaging Het
Krba1 A G 6: 48,415,744 D818G possibly damaging Het
Llgl1 G A 11: 60,712,980 G1016R probably benign Het
Loxl4 A G 19: 42,607,627 V142A probably benign Het
Mthfd1 A G 12: 76,294,218 I464V probably benign Het
Mycs C A X: 5,468,077 K316N probably damaging Het
Ncor2 A G 5: 125,026,775 probably benign Het
Nlrc3 A G 16: 3,964,045 F516S probably damaging Het
Oacyl A G 18: 65,749,672 S540G probably damaging Het
Olfml2a A T 2: 38,960,230 T653S probably damaging Het
Olfr285 C T 15: 98,313,488 V21I probably benign Het
Pcnx2 A T 8: 125,773,946 N1468K probably damaging Het
Plbd1 A G 6: 136,634,505 I258T probably damaging Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prop1 C T 11: 50,953,326 V27M probably damaging Het
Rfx4 T G 10: 84,814,761 probably null Het
Rgs11 C T 17: 26,203,463 probably benign Het
Slc6a5 T A 7: 49,945,512 F541I probably damaging Het
Srgap3 A T 6: 112,722,846 V1057E possibly damaging Het
Synpo2 A T 3: 123,114,297 W457R probably damaging Het
Tet2 T A 3: 133,487,960 N238Y possibly damaging Het
Tiam2 T A 17: 3,437,265 M687K probably damaging Het
Ticrr A G 7: 79,696,690 E1866G probably benign Het
Ugt2b37 C T 5: 87,254,406 G122D probably benign Het
Uqcrc2 A G 7: 120,637,888 E53G probably damaging Het
Vcan T C 13: 89,703,952 D963G probably damaging Het
Vmn2r24 T A 6: 123,787,267 Y368N possibly damaging Het
Wdr5 A G 2: 27,528,311 T208A probably benign Het
Zbtb18 A G 1: 177,448,370 Y423C probably damaging Het
Zc3h6 A G 2: 128,997,776 probably null Het
Other mutations in Tspan8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Tspan8 APN 10 115844139 splice site probably benign
IGL01738:Tspan8 APN 10 115817665 splice site probably null
IGL01755:Tspan8 APN 10 115835298 missense probably damaging 1.00
IGL01993:Tspan8 APN 10 115840008 splice site probably benign
IGL02369:Tspan8 APN 10 115839877 missense probably benign 0.01
IGL02369:Tspan8 APN 10 115839878 missense probably benign 0.44
PIT4131001:Tspan8 UTSW 10 115817610 missense probably damaging 1.00
R1269:Tspan8 UTSW 10 115849382 missense probably damaging 0.97
R1693:Tspan8 UTSW 10 115844044 splice site probably benign
R1850:Tspan8 UTSW 10 115833225 missense probably damaging 0.98
R1975:Tspan8 UTSW 10 115844130 missense probably benign 0.00
R1976:Tspan8 UTSW 10 115844130 missense probably benign 0.00
R1977:Tspan8 UTSW 10 115844130 missense probably benign 0.00
R4058:Tspan8 UTSW 10 115835282 nonsense probably null
R4059:Tspan8 UTSW 10 115835282 nonsense probably null
R4999:Tspan8 UTSW 10 115817629 missense possibly damaging 0.91
R6290:Tspan8 UTSW 10 115827824 missense probably damaging 0.98
R6358:Tspan8 UTSW 10 115833227 missense probably benign 0.12
R6524:Tspan8 UTSW 10 115844079 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTAGGACAATTCAAGGCTGGAAAC -3'
(R):5'- GTCCAAAACCTATGCCATAGTATCTTC -3'

Sequencing Primer
(F):5'- TCAGGAGGTGCCAACATTTC -3'
(R):5'- CCTATGCCATAGTATCTTCCATAAAC -3'
Posted On2017-02-10