Incidental Mutation 'R5879:Prop1'
ID455727
Institutional Source Beutler Lab
Gene Symbol Prop1
Ensembl Gene ENSMUSG00000044542
Gene Namepaired like homeodomain factor 1
SynonymsProp-1, prophet of Pit1, prophet of Pit-1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.780) question?
Stock #R5879 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location50950806-50953765 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 50953326 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 27 (V27M)
Ref Sequence ENSEMBL: ENSMUSP00000125413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051159] [ENSMUST00000162420]
Predicted Effect probably benign
Transcript: ENSMUST00000051159
AA Change: V27M

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000057231
Gene: ENSMUSG00000044542
AA Change: V27M

DomainStartEndE-ValueType
HOX 66 128 4.85e-25 SMART
low complexity region 150 168 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159179
Predicted Effect probably damaging
Transcript: ENSMUST00000162420
AA Change: V27M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a paired-like homeodomain transcription factor in the developing pituitary gland. Expression occurs prior to and is required for expression of pou domain transcription factor 1, which is responsible for pituitary development and hormone expression. Mutations in this gene have been associated with combined pituitary hormone deficiency-2 as well as deficiencies in luteinizing hormone, follicle-stimulating hormone, growth hormone, prolactin, and thyroid-stimulating hormone. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit severe proportional dwarfism, hypothyroidism, and sterility. Mutants fail to develop the anterior pituitary cells that secrete growth hormone, prolactin, and thyroid stimulating hormone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,874,658 L87P probably damaging Het
Aldh16a1 C T 7: 45,147,506 W66* probably null Het
Arhgap39 T C 15: 76,751,807 D76G probably damaging Het
Arhgef2 G A 3: 88,643,617 probably null Het
C1qtnf2 T C 11: 43,486,008 M99T probably damaging Het
Eml3 G A 19: 8,935,015 C392Y possibly damaging Het
Ephb4 C A 5: 137,360,416 P287Q probably benign Het
Fat4 G T 3: 38,887,336 R126L probably benign Het
Flt3 T C 5: 147,334,909 M858V probably damaging Het
Gm13083 A T 4: 143,617,591 Y487F possibly damaging Het
Gprin3 A C 6: 59,354,713 I203R probably benign Het
Insr G T 8: 3,198,173 Y457* probably null Het
Ipo13 G A 4: 117,903,203 T649I possibly damaging Het
Krba1 A G 6: 48,415,744 D818G possibly damaging Het
Llgl1 G A 11: 60,712,980 G1016R probably benign Het
Loxl4 A G 19: 42,607,627 V142A probably benign Het
Mthfd1 A G 12: 76,294,218 I464V probably benign Het
Mycs C A X: 5,468,077 K316N probably damaging Het
Ncor2 A G 5: 125,026,775 probably benign Het
Nlrc3 A G 16: 3,964,045 F516S probably damaging Het
Oacyl A G 18: 65,749,672 S540G probably damaging Het
Olfml2a A T 2: 38,960,230 T653S probably damaging Het
Olfr285 C T 15: 98,313,488 V21I probably benign Het
Pcnx2 A T 8: 125,773,946 N1468K probably damaging Het
Plbd1 A G 6: 136,634,505 I258T probably damaging Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Rfx4 T G 10: 84,814,761 probably null Het
Rgs11 C T 17: 26,203,463 probably benign Het
Slc6a5 T A 7: 49,945,512 F541I probably damaging Het
Srgap3 A T 6: 112,722,846 V1057E possibly damaging Het
Synpo2 A T 3: 123,114,297 W457R probably damaging Het
Tet2 T A 3: 133,487,960 N238Y possibly damaging Het
Tiam2 T A 17: 3,437,265 M687K probably damaging Het
Ticrr A G 7: 79,696,690 E1866G probably benign Het
Tspan8 T C 10: 115,833,251 S64P possibly damaging Het
Ugt2b37 C T 5: 87,254,406 G122D probably benign Het
Uqcrc2 A G 7: 120,637,888 E53G probably damaging Het
Vcan T C 13: 89,703,952 D963G probably damaging Het
Vmn2r24 T A 6: 123,787,267 Y368N possibly damaging Het
Wdr5 A G 2: 27,528,311 T208A probably benign Het
Zbtb18 A G 1: 177,448,370 Y423C probably damaging Het
Zc3h6 A G 2: 128,997,776 probably null Het
Other mutations in Prop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01676:Prop1 APN 11 50952129 missense probably damaging 1.00
IGL02192:Prop1 APN 11 50953286 splice site probably benign
IGL02219:Prop1 APN 11 50952084 missense probably damaging 1.00
IGL02551:Prop1 APN 11 50950946 missense possibly damaging 0.83
R1642:Prop1 UTSW 11 50953325 missense possibly damaging 0.46
R4909:Prop1 UTSW 11 50952036 frame shift probably null
R4909:Prop1 UTSW 11 50952045 missense probably damaging 1.00
R5743:Prop1 UTSW 11 50951009 missense probably damaging 1.00
R6324:Prop1 UTSW 11 50952199 missense probably benign 0.03
R6721:Prop1 UTSW 11 50953386 missense probably benign 0.27
R7162:Prop1 UTSW 11 50952054 missense probably damaging 0.99
RF005:Prop1 UTSW 11 50951130 missense possibly damaging 0.69
RF024:Prop1 UTSW 11 50951130 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GGTCCCCAAAGCTCCAATTC -3'
(R):5'- AACTGTGAGAAAACAGGTATCTAGC -3'

Sequencing Primer
(F):5'- AAGCTCCAATTCTGCTTTCCAC -3'
(R):5'- CACAGAGCAAGGGACAGACTC -3'
Posted On2017-02-10