Incidental Mutation 'R5879:Llgl1'
ID455728
Institutional Source Beutler Lab
Gene Symbol Llgl1
Ensembl Gene ENSMUSG00000020536
Gene NameLLGL1 scribble cell polarity complex component
SynonymsLgl1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5879 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location60699723-60714186 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 60712980 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 1016 (G1016R)
Ref Sequence ENSEMBL: ENSMUSP00000104359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002889] [ENSMUST00000052346] [ENSMUST00000108719]
Predicted Effect probably benign
Transcript: ENSMUST00000002889
SMART Domains Protein: ENSMUSP00000002889
Gene: ENSMUSG00000002812

DomainStartEndE-ValueType
LRR 55 78 1.08e-1 SMART
LRR 103 126 4.08e0 SMART
LRR 127 149 2.27e1 SMART
LRR 150 173 1.25e-1 SMART
LRR 222 244 6.78e1 SMART
LRR 245 268 2.86e-1 SMART
LRR 269 291 3.78e-1 SMART
LRR 316 339 2.82e0 SMART
LRR 340 362 2.27e2 SMART
low complexity region 403 420 N/A INTRINSIC
GEL 499 597 4.17e-25 SMART
GEL 617 709 1.72e-26 SMART
low complexity region 727 740 N/A INTRINSIC
GEL 745 838 2.24e-25 SMART
GEL 905 1039 1.13e-3 SMART
GEL 1056 1152 7.28e-16 SMART
GEL 1167 1263 5.51e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052346
AA Change: G1016R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000060749
Gene: ENSMUSG00000020536
AA Change: G1016R

DomainStartEndE-ValueType
WD40 22 62 4.42e1 SMART
WD40 64 103 1.65e1 SMART
WD40 187 223 2.74e2 SMART
WD40 226 264 2.06e0 SMART
Pfam:LLGL 278 379 1.2e-43 PFAM
WD40 424 460 3.2e0 SMART
Blast:WD40 498 541 2e-13 BLAST
Blast:WD40 585 624 4e-9 BLAST
Pfam:Lgl_C 732 978 1.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108719
AA Change: G1016R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000104359
Gene: ENSMUSG00000020536
AA Change: G1016R

DomainStartEndE-ValueType
WD40 22 62 4.42e1 SMART
WD40 64 103 1.65e1 SMART
WD40 187 223 2.74e2 SMART
WD40 226 264 2.06e0 SMART
Pfam:LLGL 275 379 2e-48 PFAM
WD40 424 460 3.2e0 SMART
Blast:WD40 498 540 2e-13 BLAST
Blast:WD40 585 624 4e-9 BLAST
Pfam:Lgl_C 804 976 1.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154141
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to a tumor suppressor in Drosophila. The protein is part of a cytoskeletal network and is associated with nonmuscle myosin II heavy chain and a kinase that specifically phosphorylates this protein at serine residues. The gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die neonatally exhibiting hydroencephaly. Neural progenitor cell physiology is abnormal, resulting in a loss of cell polarity and the development of neuroepithelial rosette-like structures throughout the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,874,658 L87P probably damaging Het
Aldh16a1 C T 7: 45,147,506 W66* probably null Het
Arhgap39 T C 15: 76,751,807 D76G probably damaging Het
Arhgef2 G A 3: 88,643,617 probably null Het
C1qtnf2 T C 11: 43,486,008 M99T probably damaging Het
Eml3 G A 19: 8,935,015 C392Y possibly damaging Het
Ephb4 C A 5: 137,360,416 P287Q probably benign Het
Fat4 G T 3: 38,887,336 R126L probably benign Het
Flt3 T C 5: 147,334,909 M858V probably damaging Het
Gm13083 A T 4: 143,617,591 Y487F possibly damaging Het
Gprin3 A C 6: 59,354,713 I203R probably benign Het
Insr G T 8: 3,198,173 Y457* probably null Het
Ipo13 G A 4: 117,903,203 T649I possibly damaging Het
Krba1 A G 6: 48,415,744 D818G possibly damaging Het
Loxl4 A G 19: 42,607,627 V142A probably benign Het
Mthfd1 A G 12: 76,294,218 I464V probably benign Het
Mycs C A X: 5,468,077 K316N probably damaging Het
Ncor2 A G 5: 125,026,775 probably benign Het
Nlrc3 A G 16: 3,964,045 F516S probably damaging Het
Oacyl A G 18: 65,749,672 S540G probably damaging Het
Olfml2a A T 2: 38,960,230 T653S probably damaging Het
Olfr285 C T 15: 98,313,488 V21I probably benign Het
Pcnx2 A T 8: 125,773,946 N1468K probably damaging Het
Plbd1 A G 6: 136,634,505 I258T probably damaging Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prop1 C T 11: 50,953,326 V27M probably damaging Het
Rfx4 T G 10: 84,814,761 probably null Het
Rgs11 C T 17: 26,203,463 probably benign Het
Slc6a5 T A 7: 49,945,512 F541I probably damaging Het
Srgap3 A T 6: 112,722,846 V1057E possibly damaging Het
Synpo2 A T 3: 123,114,297 W457R probably damaging Het
Tet2 T A 3: 133,487,960 N238Y possibly damaging Het
Tiam2 T A 17: 3,437,265 M687K probably damaging Het
Ticrr A G 7: 79,696,690 E1866G probably benign Het
Tspan8 T C 10: 115,833,251 S64P possibly damaging Het
Ugt2b37 C T 5: 87,254,406 G122D probably benign Het
Uqcrc2 A G 7: 120,637,888 E53G probably damaging Het
Vcan T C 13: 89,703,952 D963G probably damaging Het
Vmn2r24 T A 6: 123,787,267 Y368N possibly damaging Het
Wdr5 A G 2: 27,528,311 T208A probably benign Het
Zbtb18 A G 1: 177,448,370 Y423C probably damaging Het
Zc3h6 A G 2: 128,997,776 probably null Het
Other mutations in Llgl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Llgl1 APN 11 60709999 missense probably benign 0.38
IGL01400:Llgl1 APN 11 60706490 missense probably damaging 1.00
IGL03066:Llgl1 APN 11 60706034 missense possibly damaging 0.75
IGL03174:Llgl1 APN 11 60706210 missense probably benign 0.15
IGL03306:Llgl1 APN 11 60711354 missense possibly damaging 0.92
R0284:Llgl1 UTSW 11 60712141 missense probably damaging 0.98
R1137:Llgl1 UTSW 11 60704733 missense probably benign 0.01
R1432:Llgl1 UTSW 11 60708554 missense probably damaging 1.00
R1769:Llgl1 UTSW 11 60707047 missense probably damaging 1.00
R1786:Llgl1 UTSW 11 60707240 missense probably benign 0.19
R1835:Llgl1 UTSW 11 60704730 missense probably benign 0.00
R1943:Llgl1 UTSW 11 60706016 missense probably benign
R2197:Llgl1 UTSW 11 60710039 missense possibly damaging 0.62
R2510:Llgl1 UTSW 11 60710036 missense probably damaging 1.00
R2568:Llgl1 UTSW 11 60708812 missense probably damaging 1.00
R3690:Llgl1 UTSW 11 60707002 missense probably damaging 1.00
R3853:Llgl1 UTSW 11 60707249 missense probably damaging 1.00
R4079:Llgl1 UTSW 11 60710284 splice site probably null
R4259:Llgl1 UTSW 11 60709568 missense probably benign
R4348:Llgl1 UTSW 11 60709568 missense probably benign
R4349:Llgl1 UTSW 11 60709568 missense probably benign
R4352:Llgl1 UTSW 11 60709568 missense probably benign
R4353:Llgl1 UTSW 11 60709568 missense probably benign
R4396:Llgl1 UTSW 11 60706008 missense probably benign
R4584:Llgl1 UTSW 11 60712082 missense probably damaging 0.99
R4594:Llgl1 UTSW 11 60706321 missense probably benign 0.15
R4628:Llgl1 UTSW 11 60709985 missense probably damaging 1.00
R4651:Llgl1 UTSW 11 60708651 missense possibly damaging 0.80
R4653:Llgl1 UTSW 11 60708651 missense possibly damaging 0.80
R4731:Llgl1 UTSW 11 60706225 nonsense probably null
R4869:Llgl1 UTSW 11 60707210 nonsense probably null
R4898:Llgl1 UTSW 11 60709568 missense probably benign
R4899:Llgl1 UTSW 11 60709568 missense probably benign
R4939:Llgl1 UTSW 11 60709979 critical splice acceptor site probably null
R4941:Llgl1 UTSW 11 60709568 missense probably benign
R4942:Llgl1 UTSW 11 60709568 missense probably benign
R4958:Llgl1 UTSW 11 60711435 missense probably benign 0.02
R4995:Llgl1 UTSW 11 60709724 missense probably benign 0.00
R4997:Llgl1 UTSW 11 60709568 missense probably benign
R5177:Llgl1 UTSW 11 60712007 missense possibly damaging 0.94
R5257:Llgl1 UTSW 11 60711563 unclassified probably null
R5258:Llgl1 UTSW 11 60711563 unclassified probably null
R5401:Llgl1 UTSW 11 60706471 missense probably benign
R5406:Llgl1 UTSW 11 60713184 missense probably damaging 0.99
R5432:Llgl1 UTSW 11 60707623 missense probably benign
R5587:Llgl1 UTSW 11 60710342 missense probably benign 0.00
R5732:Llgl1 UTSW 11 60709460 missense probably benign 0.00
R5758:Llgl1 UTSW 11 60708567 missense probably damaging 1.00
R6268:Llgl1 UTSW 11 60712163 missense probably benign 0.13
R6286:Llgl1 UTSW 11 60709532 missense probably damaging 1.00
R6455:Llgl1 UTSW 11 60709660 missense probably damaging 0.98
R6805:Llgl1 UTSW 11 60702865 missense probably benign 0.25
R6929:Llgl1 UTSW 11 60710353 nonsense probably null
R7274:Llgl1 UTSW 11 60705986 missense possibly damaging 0.89
R7889:Llgl1 UTSW 11 60707312 missense probably damaging 1.00
R7972:Llgl1 UTSW 11 60707312 missense probably damaging 1.00
R8141:Llgl1 UTSW 11 60710316 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CGTAAGCTCAGGTTCCACTG -3'
(R):5'- CATTTAATCAGAAGGGTGTAGGC -3'

Sequencing Primer
(F):5'- TCAGGTTCCACTGAGCCAG -3'
(R):5'- TGTAGGCCCGACAAGCATC -3'
Posted On2017-02-10